CEP104 (NM_014704) Human Untagged Clone

CAT#: SC114917

Reviews ()
Write a review

CEP104 (untagged)-Human centrosomal protein 104kDa (CEP104)



Reconstitution Protocol

USD 848.00


Availability*
In Stock

Size
    • 10 ug


Product images

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CEP104
Synonyms CFAP256; GlyBP; JBTS25; KIAA0562; ROC22
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF within SC114917 sequence for NM_014704 edited (data generated by NextGen Sequencing)
ATGCCCCACAAGATTGGATTTGTAGTCGTCAGCTCATCTGGACACGAAGACGGCTTCAGT
GCCCGGGAGCTCATGATCCACGCGCCAACTGTCAGTGGGTGGCGGTCACCTAGATTTTGC
CAGTTTCCACAAGAAATTGTCCTTCAAATGGTGGAGAGATGTCGAATAAGGAAACTGCAG
TTACTTGCTCACCAGTATATGATTTCAAGTAAAATTGAGTTCTACATTAGTGAAAGCTTG
CCTGAATATTTTGCACCCTATCAAGCAGAGCGGTTTCGAAGACTTGGCTACGTGTCTCTC
TGTGATAATGAAAAGACAGGTTGCAAAGCCCGGGAACTAAAATCAGTTTATGTGGATGCA
GTAGGACAATTTCTTAAACTGATTTTTCACCAAAACCATGTCAACAAATACAACATATAT
AATCAGGTTGCTTTGGTTGCCATAAATATCATTGGAGACCCTGCAGATTTCAGTGATGAA
AGCAATACTGCCTCTCGAGAGAAGTTGATTGACCACTACCTTGGGCACAACAGCGAGGAC
CCTGCTCTAGAAGGAACGTACGCCAGGAAATCTGACTATATCTCTCCGCTAGATGACTTA
GCTTTTGATATGTACCAAGATCCAGAAGTTGCACAGATCATACGAAAATTAGATGAAAGA
AAACGGGAAGCTGTCCAAAAGGAACGCTATGATTATGCCAAGAAACTAAAACAAGCCATT
GCTGATTTGCAAAAGGTTGGTGAACGCCTTGGGAGGTATGAGGTAGAGAAACGCTGTGCC
GTGGAGAAGGAAGACTACGATCTCGCCAAGGAGAAGAAGCAGCAGATGGAGCAGTATCGT
GCCGAGGTGTACGAGCAGCTGGAGCTGCACAGCCTCCTGGATGCCGAGCTGATGCGAAGA
CCTTTTGATTTGCCCCTCCAGCCCCTCGCTCGTTCTGGCAGTCCTTGCCACCAAAAGCCA
ATGCCCTCACTACCACAACTGGAAGAAAGAGGAACAGAAAACCAGTTTGCAGAACCTTTC
CTTCAGGAAAAGCCTTCATCATATTCTCTAACTATTTCTCCTCAGCATTCTGCAGTAGAC
CCGTTACTCCCTGCCACAGATCCTCATCCAAAGATCAATGCAGAGTCCCTGCCCTACGAT
GAGCGGCCTCTTCCAGCTATTCGTAAGCATTATGGGGAGGCAGTGGTGGAGCCGGAAATG
AGTAATGCAGACATCAGCGATGCTCGGAGGGGAGGCATGTTAGGGGAGCCAGAGCCCTTA
ACCGAGAAGGCCTTGAGAGAAGCCAGCTCTGCCATCGATGTGTTGGGAGAAACCTTGGTT
GCTGAGGCCTATTGTAAGACGTGGTCCTACCGAGAGGATGCACTGCTTGCCTTGTCTAAG
AAGTTAATGGAAATGCCTGTTGGAACCCCAAAAGAAGATTTAAAGAACACACTGAGAGCA
TCCGTCTTTCTCGTTAGAAGAGCCATAAAGGACATTGTGACCTCCGTTTTTCAGGCTTCT
TTGAAATTGTTGAAAATGATCATTACACAATATATTCCTAAACATAAACTGAGTAAACTT
GAAACAGCTCACTGTGTGGAGAGGACCATTCCCGTTTTGCTCACCAGAACTGGAGATTCT
TCTGCCCGCCTCCGCGTCACAGCTGCAAATTTTATTCAGGAAATGGCCTTGTTTAAAGAA
GTTAAGTCTCTCCAAATTATTCCATCCTACCTGGTGCAGCCATTGAAAGCAAACTCTTCA
GTTCACCTGGCAATGAGTCAGATGGGCCTCCTGGCCCGGCTGCTGAAAGACCTGGGCACT
GGCAGCTCGGGCTTCACCATTGACAACGTGATGAAGTTTTCAGTGAGTGCCCTGGAGCAT
AGAGTGTATGAGGTCCGCGAGACGGCGGTTCGAATTATTTTGGACATGTACAGACAGCAC
CAGGCTTCCATCCTGGAGTACCTTCCTCCAGACGACAGCAACACACGCAGGAACATTCTC
TACAAAACAATTTTTGAGGGATTTGCTAAAATAGATGGCAGAGCTACAGATGCTGAGATG
AGGGCACGGAGAAAAGTGGCTACAGAAGAAGCAGAAAAACAAAAGAAAGAAGAAATAAAA
GCTTTACAAGGGCAGCTGGCAGCACTGAAAGAAATTCAGGCTGAAGTTCAGGAAAAAGAA
AGTGATGCTGTGAAGCCAAAGAATCAGGACATTCAAGGAGGGAAAGCAGCCCCTGCTGAA
GCTCTGGGAATCCCGGATGAGCACTATCTAGATAATTTGTGTATTTTTTGTGGGGAAAGG
AGTGAATCCTTCACAGAGGAAGGTCTGGATCTCCACTACTGGAAGCACTGTCTCATGCTG
ACAAGATGTGACCACTGCAAACAGGTGGTCGAGATATCCAGTCTGACGGAGCACTTGCTG
ACGGAATGTGACAAAAAAGACGGGTTTGGAAAGTGTTACCGTTGCAGTGAGGCTGTTTTC
AAGGAAGAGCTGCCCAGACACATAAAACACAAGGATTGCAACCCTGCCAAACCGGAGAAG
CTGGCAAACCGGTGTCCCCTGTGTCATGAGAACTTCAGCCCTGGAGAAGAGGCATGGAAA
GCTCACCTGATGGGCCCAGCCGGCTGCACGATGAACCTGCGCAAGACACACATTCTGCAG
AAGGCCCCGGCACTGCAGCCAGGGAAAAGCTCAGCTGTGGCCGCATCAGGCCCCTTGGGG
TCAAAGGCCGGAAGCAAGATCCCCACCCCGAAGGGCGGACTGAGCAAGAGCTCCAGCAGG
ACGTACGCCAAGCGCTGA

Clone variation with respect to NM_014704.3
2057 c=>t
>OriGene 5' read for NM_014704 unedited
ATTCGGCACGAGGTGGAGGCTGCGGCCGGGGCTATGGGCAGAGGTGGCCGGGTCTGCTTC
TTCCCTGTCACTGCCGCAGCAGCTTGGGGTGCAAGGCGGCCTGGGGCGGCGGAAGGGGCG
CCCCCCGAGTTCCGTCTGAGGAAGCGGCGGCTGCCGAGGAAGTCCACGAGAGCCGGGTCC
CGCACGCCCCTGGGGTCCGGGTGCTGAGGCGCCGCCTGGCCGCCTCCCCGGGCCGCGGCA
CCGCTCCGACCCAGCCGCCCTCTCCACCGGGGCCGCGGCAGCGCCAGTCGGGGCCCTTCC
CTCTAAGCAGCCCAAACGTGCAGAATGCCCCACAAGATTGGATTTGTAGTCGTCAGCTCA
TCTGGACACGAAGACGGCTTCAGTGCCCGGGAGCTCATGATCCACGCGCCAACTGTCAGT
GGGTGGCGGGCACCTAGATTTTGCCAGTTTCCACAAGAAATTGTCCTTCAAATGGTGGAG
AGATGTCCAATAACGAAACTGCAGTTACTTGCTCACCAGTATATGATTTCAAGTAAAATT
GAGGTCTACCTTACTGAAAGCTTGCCTGAATATTTTGCACCCTATCAGCAGAGCGGTTTC
AAGACTTGGCTACGTGGCTCTCTGTGATATGGAAAGCAAGTTGCAAGCCCCGGAACTAAA
ATAGTTTATGTGATGCAGAGGACAATTTTTAACCGATTTTACCCAACCATGGTACAAAAC
ACCATTATATCCGGTGGTTTGGTGCATAATATATTGGGGACCT
>OriGene 3' read for NM_014704 unedited
CTTGGACCCGGCCGCAATCTAGGATCGAGTTTTTTTTTTTTTTTTTTTTTTTAGGNCTCT
TTTGCCTTTATTTCTTGCTATAGTGGGAACGTGAGTTCTGCTACCTGGGGCTGAGTGCAC
TGGGCAGCAGGCCCAGCAGACGGGGCCTGCAGGGGGAAGGCACGGCTGGAGGCCCGTGCG
CACCGCCACTCTTCTGGAACCGCTGCTGGCCGAGCCACAGCCCTGCGGAAATTCTACTGC
GTGTGGCAGAGACCGATGTGCAAAAGGTTTCTGGGGAATGTTTTATGGAAATTGCTCCAA
GCACTAAGGAAAGCGGGACCGTGCCTGTGCTGACCGTGGCCTTGCGCGACCGCCTCCCTG
GCGGGGCTCTTTGGCTCTCTTCAAACAGGACGCTTCCTTCTCTGATTCTAAGGAAGGCCT
GACACACCCCTGAAGGCTTAATGTACAGCGCGGCCCGGTCCTGGCCCTGGGCCCATGACC
CTTGGCTCGCTGCATCCATAACGGTTGCACCAGCATCTCACGGCTCAGACCGCCATACAC
GCCTCCCCGCGGCCCGTCTTTTGCCTCCGAGTCCCGCCGTGTCGGGCCCGCGCGTCGGCG
TTCCGTCGCCCTNTCCGTTCAACGTGGTCCCCGCGCGGCTCCGTCTCGTGCCCCCCCCCC
CGACTTCCCCCCGCCCTCTTTTTCGTATTTCCCCCCATCCCTTCCCCCGCTCCTTCTTTC
CTCCCCCTTTTCCTCTCACTTCCGCGTCCTTCCTATCTCGCCTAGCCATTCCGTCCTCCC
GTCTTTTTCTCTCCCCGCCCCCTCCTTTTTTCCGTTTTCCCCCCCCCCGCGTTCTCCATC
CCCCATTCCCCCGCCCCCCCTGCCGCCCTCCTTCCCCCCGCCCCCCGCGTCCCCCCCTTG
GTAATCCTGTCCGGCCCCCTGACCGTCCTCCCCCTTTTCTCTCCCCATTTTCATTTTTTT
TCTCCTACCCCC
Restriction Sites NotI-NotI     
ACCN NM_014704
Insert Size 3900 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_014704.1, NP_055519.1
RefSeq Size 5848 bp
RefSeq ORF 2778 bp
Locus ID 9731
UniProt ID O60308
Cytogenetics 1p36.32
Gene Summary This gene encodes a centrosomal protein required for ciliogenesis and for ciliary tip structural integrity. The mammalian protein contains three amino-terminal hydrophobic domains, two glycosylation sites, four cysteine-rich motifs, and two regions with homology to the glutamate receptor ionotropic, NMDA 1 protein. During ciliogenesis, the encoded protein translocates from the distal tips of the centrioles to the tip of the elongating cilium. Knockdown of the protein in human retinal pigment cells results in severe defects in ciliogenesis with structural deformities at the ciliary tips. Allelic variants of this gene are associated with the autosomal-recessive disorder Joubert syndrome, which is characterized by a distinctive mid-hindbrain and cerebellar malformation, oculomotor apraxia, irregular breathing, developmental delay, and ataxia. [provided by RefSeq, Feb 2016]
Other products for "CEP104"
Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.