WDR61 (NM_025234) Human Untagged Clone

CAT#: SC110036

Reviews ()
Write a review

WDR61 (untagged)-Human WD repeat domain 61 (WDR61)



Reconstitution Protocol

USD 300.00


Availability*
In Stock

Size
    • 10 ug


Product images

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol WDR61
Synonyms REC14; SKI8
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF within SC110036 sequence for NM_025234 edited (data generated by NextGen Sequencing)
ATGACCAACCAGTACGGTATTCTCTTCAAACAAGAGCAAGCCCATGATGATGCCATTTGG
TCAGTTGCTTGGGGGACAAACAAGAAGGAAAACTCTGAGACAGTGGTCACAGGCTCCCTA
GATGACCTGGTGAAGGTCTGGAAATGGCGTGATGAGAGGCTGGACCTACAGTGGAGTCTG
GAGGGACATCAGCTGGGAGTGGTGTCTGTGGACATCAGCCACACCCTGCCCATTGCTGCA
TCCAGCTCTCTTGATGCTCATATTCGTCTTTGGGACTTGGAAAATGGCAAACAGATAAAG
TCCATAGATGCAGGACCTGTGGATGCCTGGACTTTGGCCTTTTCTCCTGATTCCCAGTAT
CTGGCCACAGGAACTCATGTCGGGAAAGTGAACATTTTTGGTGTGGAAAGTGGGAAAAAG
GAATATTCTTTGGACACGAGAGGAAAATTCATTCTTAGTATTGCATATAGTCCTGATGGG
AAATACCTAGCCAGTGGAGCCATAGATGGAATCATCAATATTTTTGATATTGCAACTGGA
AAACTTCTGCATACCCTGGAAGGCCATGCCATGCCCATTCGCTCCTTGACCTTTTCCCCG
GACTCCCAGCTCCTTGTCACTGCTTCAGATGATGGCTACATCAAGATCTATGATGTACAA
CATGCCAATTTGGCTGGCACGCTGAGCGGCCATGCCTCCTGGGTGCTGAACGTTGCATTC
TGTCCTGATGACACTCACTTTGTTTCCAGTTCGTCTGACAAAAGTGTAAAAGTTTGGGAT
GTTGGAACGAGGACTTGTGTTCACACCTTCTTTGATCACCAGGATCAGGTCTGGGGAGTA
AAATACAATGGAAATGGTTCAAAAATTGTGTCTGTTGGAGATGACCAGGAAATTCACATC
TATGATTGTCCAATTTAA

Clone variation with respect to NM_025234.1
78 g=>a
>OriGene 5' read for NM_025234 unedited
GCCATTTTTGTNAATACGAACTCACTATAGGGCGGCNCGCGATTCGGCACGAGGATCTTT
GCGCGTCGCAGTCGCGCGGAGCCCGGCTTCCGACGTGCAGCCTGGCAGTGCAGTGAGCTG
TCTGGCCTTTTGTCCTTGATCCTTGGTTAAGGAAATGACCAACCAGTACGGTATTCTCTT
CAAACAAGAGCAAGCCCATGATGATGCCATTTGGTCAGTTGCTTGGGGGACAAACAAGAA
GGAAAACTCTGAGACAGTGGTCACAGGCTCCCTAGATGACCTGGTGAAGGTCTGGAAATG
GCGTGATGAGAGGCTGGACCTACAGTGGAGTCTGGAGGGACATCAGCTGGGAGTGGTGTC
TGTGGACATCAGCCACACCCTGCCCATTGCTGCATCCAGCTCTCTTGATGCTCATATTCG
TCTTTGGGACTTGGAAAATGGCAAACAGATAAAGTCCATAGATGCAGGACCTGTGGATGC
CTGGACTTTGGCCTTTTCTCCTGATTCCCAGTATCTGGCCACAGGAACTCATGTCGGGAA
AGTGAACATTTTTGGTGTGGAAAGTGGGAAAAAGGAATATTCTTTGGACACGAGAGGAAA
ATTCATTCTTAGTATTGCATATAGTCCTGATGGGAAATACCTAGCCAGTGGAGCCATAGA
TGGAATTATCAATCATTTTGATTTTGCAACTGGGAAAATTCTTGCTACCCCTGAAGGCCA
TGCCATGCCCATTTCCTCCTTGACCTTTTCCCCGACTTCCAATTCCTTGCCACTGTTTCA
AAGAGGGCTCCATAAGCACTATGATGACAACATGCCATTTTGCCTGCACGCTGAGGGCCC
ATGCTCCTGGGGGCTACGTTGCTTTTC
>OriGene 3' read for NM_025234 unedited
NAGCTTGNACCCGGCCGCAATCTAGAGTCGAGTTTTTTTTTTTTTTTTTTGCATTAAAAA
AGCTTTATGTTAAAGTATGAACAGCATTTCCAATAAAACATGAAAAGATTCATATTGTAT
CTACAAAATTTAAGTCTTTGCTACAATAAATGCTATATTTCTTTTAAACAAGCCTAAGAA
GGTAAGGAATGTCATGATCAATCCGTACATTCTCTTTGCAGCATAAGCCTGGAGACTTTG
ATGTTTAAATTGGACAATCATAGATGTGAATTTCCTGGTCATCTCCAACAGACACAATTT
TTGAACCATTTCCATTGTATTTTACTCCCCAGACCTGATCCTGGTGATCAAAGAAGGTGT
GAACACAAGTCCTCGTTCCAACATCCCAAACTTTTACACTTTTGTCAGACGAACTGGAAA
CAAAGTGAGTGTCATCAGGACAGAATGCAACGTTCAGCACCCAGGAGGCATGGCCGCTCA
GCGTGCCAGCCAAATTGGCATGTTGTACATCATAGATCTTGATGTAGCCATCATCTGAAG
CAGTGACAAGGAGCTGGGAGTCCGGGGAAAAGGTCAAGGAGCGAATGGGCATGGCATGGC
CTTCCAGGGTATGCAGAAGTTTTCCAGTTGCAATATCAAAAATATTGATGATTCCATCTA
TGGCTCCACTGGCTAGGTATTTCCCATCANGACTATATGCAATACTAAGAATGAATTTTC
CTCTCGTGTTCAAAGAATATTNCTTTTTTCCCACTTTCCACACCAAAATGTTCACTTTTC
CCGCCTGAGTTCCCGCGGCCAGATACTGGGGATCAAGAGAATAAGCCAAAGTCCAGCCTC
CACAAGTCCTGCATTTATGAACTTTATGTGTTTGCCTTTTCCCAGGTCCCAAGACCATTA
TGACCCTCAAGAAAGCTGGATGCACAATTGGCCACGGTTGTGCCTTAAGTCCACAAACAC
CCTCCAACTCTAG
Restriction Sites NotI-NotI     
ACCN NM_025234
Insert Size 1140 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_025234.1, NP_079510.1
RefSeq Size 1205 bp
RefSeq ORF 918 bp
Locus ID 80349
UniProt ID Q9GZS3
Cytogenetics 15q25.1
Domains WD40
Protein Pathways RNA degradation
Gene Summary WDR61 is a subunit of the human PAF and SKI complexes, which function in transcriptional regulation and are involved in events downstream of RNA synthesis, such as RNA surveillance (Zhu et al., 2005 [PubMed 16024656]).[supplied by OMIM, Mar 2008]
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1 and 2 both encode the same isoform (a).
Other products for "WDR61"
Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.