p38(CRK) (NM_005206) Human Untagged Clone

CAT#: SC109105

CRK (untagged)-Human v-crk sarcoma virus CT10 oncogene homolog (avian) (CRK), transcript variant I

USD 196


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name p38(CRK) (NM_005206) Human Untagged Clone
Symbol CRK
Synonyms CRKII; p38
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_005206, the custom clone sequence may differ by one or more nucleotides


ATGGCGGGCAACTTCGACTCGGAGGAGCGGAGTAGCTGGTACTGGGGGAGGTTGAGTCGGCAGGAGGCGG
TGGCGCTGCTGCAGGGCCAGCGGCACGGGGTGTTCCTGGTGCGGGACTCGAGCACCAGCCCCGGGGACTA
TGTGCTCAGCGTCTCAGAGAACTCGCGCGTCTCCCACTACATCATCAACAGCAGCGGCCCGCGCCCGCCG
GTGCCACCGTCGCCCGCCCAGCCTCCGCCCGGGGTGAGCCCCTCCAGACTCCGAATAGGAGATCAAGAGT
TTGATTCATTGCCTGCTTTACTGGAATTCTACAAAATACACTATTTGGACACTACAACGTTGATAGAACC
AGTTTCCAGATCCAGGCAGGGTAGTGGAGTGATTCTCAGGCAGGAGGAGGCGGAGTATGTGCGAGCCCTC
TTTGACTTTAATGGGAATGATGAGGAAGATCTTCCCTTTAAGAAAGGAGACATCTTGAGAATCCGGGACA
AGCCTGAAGAGCAGTGGTGGAATGCGGAGGACAGCGAAGGCAAGAGAGGGATGATTCCAGTCCCTTACGT
CGAGAAGTATAGACCTGCCTCCGCCTCAGTATCGGCTCTGATTGGAGGTCGGTGA


5' Read Nucleotide Sequence
>OriGene 5' read for NM_005206 unedited
TTTGTAATACGACTCACTATAGGGCGGCCGCGAATTCGGCACGAGGTTCGGGCGCTGCTG
TGAAGCTGAAACCGGAGCCGGTCCGCTGGGCGGCGGGCGCCGGGGGCCGGAGGGGCGCGC
GCGGCGGCGGCACCCCAGCGTTTAGGCGCGGAGGCAGCCATGGCGGGCAACTTCGACTCG
GAGGAGCGGAGTAGCTGGTACTGGGGGCGGTTGAGTCGGCAGGAGGCGGTGGCGCTGCTG
CAGGGCCAGCGGCACGGGGTGTTCCTGGTGCGGGACTCGAGCACCAGCCCCGGGGACTAT
GTGCTCAGCGTCTCAGAGAACTCGCGCGTCTCCCACTACATCATCAACAGCAGCGGCCCG
CGCCCGCCGGTGCCACCGTCGCCCGCCCAGCCTCCGCCCGGGGTGAGCCCCTCCAGACTC
CGAATAGGAGATCAAGAGTTTGATTCATTGCCTGCTTTACTGGAATTCTACAAAATACAC
TATTTGGACACTACAACGTTGATAGAACCAGTTTCCAGATCCAGGCAGGGTAGTGGAGTG
ATTCTCAGGCAGGAGGAGGCGGAGTATGTGCGAGCCCTCTTTGACTTTAATGGGAATGAT
GAGGAAGATCTTCCCTTTAAGAAAGGAGACATCTTGAGAATCCGGGACAAGCCTGAAGAG
CAGTGGTGGAATGCGGAGGACAGCGNAAGCAAGAGAGGGATGATTCCAGTCCCTTACGTC
GAGAAGTATAGACCTGCCTNCGCCTCAGTATCGGCTCTGATTGGAGGGTCGTGAGCTGGT
AAAGGNTACGAAGATTAATGTGAGTGGNTCANTGGGAANGGGGGAGTGTATGGCAANACG
AGTCACTTNCCATTACACATGTNCGTCTGCTGGATCAACAGAANTCCGATGAGGGACTCA
GCTGAGTATAGNTCAACAN
3' Read Nucleotide Sequence
>OriGene 3' read for NM_005206 unedited
TTTTTTGCTTTGTACCGGCGGCCGCAATCTAGNATCGAGTTTTTTTTTTTTTTTTTTGAG
ACTGAGTCTTGCCCTGTCGCTCAGGCTGGAACGCAGTGGTGCGATCTCGGCTCACTGCAG
CCTCCACCTCCCAGGTTGAAGCAATTCTCCTGCCTCAGCCTCCCGAGTAGCTGGGATTAC
AGGCGTGCACCACCACGCCGGGCTAATTTTTTATATCTTTAGCAGAGATGGGGTCTCACT
ATGTCGGCCAGGCTGGCCTCGAACTCCTGACCTCATGATCCACCCGCCTCGGCCTTCCAA
AGTGCTGGGATTACAGACGTGAGCCACCGTGCCCAGTCGGTCCAACATTTTTTTAAAGCA
CTAACCCTACCCCAAATTCCTGTCACTACTAGCCCCGCCTCTTATCCCCGTTGCACCCCC
TCGCAGACGGCCCCAACCTGACCCCTAAACCCTCCCCCACCACTATTATTAGGTGATATG
TTCCCTGGGACCCACCCGACCCCCACCTTCGCGACCCCCCCCGAGGCTGCCTACTCCGCC
TCCCGCCCCCTCTCGCCCTACACGGCTCGTGTCGAGACATCCTAAATTTTCTTCCTTCTA
ATCATCCCCCCTCCCCTCCTTTTCGCATTCCCCCCCGTCCCCCCTCTCCCGCAACTCTTA
CACTATCTCCCCTTCCCCCCCCTCCGCCCCCCCACCCACCCCCACACCCCGCCTTCCTCC
TCCGCCCCCACCATGGTTTTCTCCCTCTTCCGCCGCCCTCTCNTCCCACATTATATTAAT
TAATTTCGCGGCCCCCGCCCGAACCGCCCTGCGTACCCTCTCGTTGTTGTGCACCTCCTT
TCTCTTTCCCTTCCCTTCCTTCCCTCTACACCATNTTCCCCCCCTATCCCTCCTCATTCA
TGATTTCCCGCCCCCGCGATAGCCCTACAGGCCACTCCCCCCGCCGCTTCGCGTCACCAC
CGCTCCCCCGCTCGTATCTCCCTGCCCT
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_005206
ORF Size 615 bp
Insert Size 2190
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_005206.3, NP_005197
RefSeq Size 2245
RefSeq ORF 615
Locus ID 1398
Cytogenetics 17p13.3
Domains SH2, SH3
Protein Families Transcription Factors, Druggable Genome
Protein Pathways MAPK signaling pathway, ErbB signaling pathway, Chemokine signaling pathway, Focal adhesion, Fc gamma R-mediated phagocytosis, Neurotrophin signaling pathway, Regulation of actin cytoskeleton, Insulin signaling pathway, Pathways in cancer, Renal cell carcinoma, Chronic myeloid leukemia
Gene Summary This gene encodes a member of an adapter protein family that binds to several tyrosine-phosphorylated proteins. The product of this gene has several SH2 and SH3 domains (src-homology domains) and is involved in several signaling pathways, recruiting cytoplasmic proteins in the vicinity of tyrosine kinase through SH2-phosphotyrosine interaction. The N-terminal SH2 domain of this protein functions as a positive regulator of transformation whereas the C-terminal SH3 domain functions as a negative regulator of transformation. Two alternative transcripts encoding different isoforms with distinct biological activity have been described. [provided by RefSeq, Jul 2008].
Transcript Variant: This variant (I) represents the shorter transcript and encodes the shorter isoform (b). Isoform b increases transformation activity due to the loss of a SH3 domain.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.