PSME3 (NM_176863) Human Untagged Clone

CAT#: SC107168

PSME3 (untagged)-ORIGENE UNIQUE VARIANT 1 of Human proteasome (prosome, macropain) activator subunit 3 (PA28 gamma, Ki) (PSME3),

USD 618


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name PSME3 (NM_176863) Human Untagged Clone
Symbol PSME3
Synonyms HEL-S-283; Ki; PA28-gamma; PA28G; PA28gamma; REG-GAMMA
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_176863, the custom clone sequence may differ by one or more nucleotides


ATGGCCTCGTTGCTGAAGGTGGATCAGGAAGTGAAGCTCAAGGTTGATTCTTTCAGGGAGCGGATCACAA
GTGAGGCAGAAGACTTGGTGGCAAATTTTTTCCCAAAGAAGTTATTAGAACTTGATAGTTTTCTGAAGGA
ACCAATCTTAAACATCCATGACCTAACTCAGATCCACTCTGACATGAATCTCCCAGTCCCTGACCCCATT
CTTCTCACCAATAGCCATGATGGACTGGATGGTCCCACTTATAAGAAGCGAAGGTTGGATGAGTGTGAAG
AAGCCTTCCAAGGAACCAAGGTGTTTGTGATGCCCAATGGGATGCTGAAAAGCAACCAGCAGCTGGTGGA
CATTATTGAGAAAGTGAAACCTGAGATCCGGCTGTTGATTGAGAAATGTAACACGCCTTCAGGCAAAGGT
CCTCATATATGTTTTGACCTCCAGGTCAAAATGTGGGTACAGCTCCTGATTCCCAGGATAGAAGATGGAA
ACAACTTTGGGGTGTCCATTCAGGAGGAAACAGTTGCAGAGCTAAGAACTGTTGAGAGTGAAGCTGCATC
TTATCTGGACCAGATTTCTAGATATTATATTACAAGAGCCAAATTGGTTTCTAAAATAGCTAAATATCCC
CATGTGGAGGACTATCGCCGCACCGTGACAGAGATTGATGAGAAAGAATATATCAGCCTTCGGCTCATCA
TATCAGAGCTGAGGAATCAATATGTCACTCTACATGACATGATCCTGAAAAATATCGAGAAGATCAAACG
GCCCCGGAGCAGCAATGCAGAGACTCTGTACTGA


5' Read Nucleotide Sequence
>OriGene 5' read for NM_176863 unedited
TAATACGACTCACTATAGGGCGGCCGCGAATTCGGCACGAGGGCGAAAGCCGGGAGGGCG
AGCGAGAGAGCAAGCAGGCAGCAGGCTGCCGGCGGGCGGGCGGACGGCACAGAGGGAGGG
AGCGAGCGAGCAGTGAGTAAGCCAGCAAGGGCGGTCGGGTCCCGAGGTCAGCCGAGATTT
CTCAGGTCCCTCCGGCCCCCTCCCTGGAGTCCACAGCGCCTCCGGTGTCCAGAGGATCGG
ACACGGCCCGGCCCGGCCATGGCCTCGTTGCTGAAGGTGGATCAGGAAGTGAAGCTCAAG
GTTGATTCTTTCAGGGAGCGGATCACAAGTGAGGCAGAAGACTTGGTGGCAAATTTTTTC
CCAAAGAAGTTATTAGAACTTGATAGTTTTCTGAAGGAACCAATCTTAAACATCCATGAC
CTAACTCAGATCCACTCTGACATGAATCTCCCAGTCCCTGACCCCATTCTTCTCACCAAT
AGCCATGATGGACTGGATGGTCCCACTTATAAGAAGCGAAGGTTGGATGAGTGTGAAGAA
GCCTTCCAAGGAACCAAGGTGTTTGTGATGCCCAATGGGATGCTGAAAAGCAACCAGCAG
CTGGTGGACATTATTGAGAAAGTGAAACCTGAGATCCGGCTGTTGATTGAGAAATGTAAC
ACGGTCAAAATGTGGGTACAGCTCCTGATTCCCAGGATAGAAGATGGAAACAACTTTGGG
GTGTCCATTCAGGAGGAAACAGTTGCAGAGCTAAGAACTGTTGAGAGTGAAGCTGCATCT
TATCTGGACCCAGATTCTAGATATATATTACAAGAGCCANNATGGTTTCTAAATAGCTAA
TATNCCCATGTGGAGGACTATCGNCGCACGTGACAGAGATGATGAGAAGAATTATCAGCC
TTCGCTCATATATAAAGCTGAGATATATGTACTCTACTGACTGATCTGAAATATCAGAGA
CAACGCC
3' Read Nucleotide Sequence
>OriGene 3' read for NM_176863 unedited
GGTCACAGGGCTGCCACCCGGGTTCTGTTCAGGAAACAGCTATGACCGCGGCCGCAATCT
AGAGTCGAGTTTTTTTTTTTTTTTTTTGTTTTTTTTTTAGAGGTCAAAGTACCTGTATTT
TTAATAATTTCTTGACATGGTAAAAGAATTTTACATTACGATCCATGGGTGATAGGGTGA
GGAGGA
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_176863
ORF Size 804 bp
Insert Size 2600
OTI Disclaimer The sequence of an 'OriGene Unique Variant' differs significantly from the associated reference. It represents a novel splice variant from the same gene locus of the reference. Although such variants are true transcripts and present opportunity for discoveries, they are not yet curated by NCBI and should not be used if the exact reference accession sequence is required.
OTI Annotation This TrueClone was found to represent an alternative form of the specific reference to which it is associated. Its Open Reading Frame (ORF) may represent a novel form or alternative splice variant. By virtue of it being a true transcript (cDNA clone not PCR product), it provides a biologically relevant copy of its mRNA template. For more details, please evaluate the sequence information provided on this website or contact our customer care specialists.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_176863.1, NP_789839
RefSeq Size 3228
RefSeq ORF 804
Locus ID 10197
Cytogenetics 17q21.31
Protein Families Stem cell - Pluripotency
Protein Pathways Proteasome, Antigen processing and presentation
Gene Summary The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. The immunoproteasome contains an alternate regulator, referred to as the 11S regulator or PA28, that replaces the 19S regulator. Three subunits (alpha, beta and gamma) of the 11S regulator have been identified. This gene encodes the gamma subunit of the 11S regulator. Six gamma subunits combine to form a homohexameric ring. Alternate splicing results in multiple transcript variants. [provided by RefSeq, May 2012]
Transcript Variant: This variant (2), uses ans alternate in-frame splice site, compared to variant 1. The resulting isoform (2) is longer than isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.