Axin 2(AXIN2) (BC006295) Human Untagged Clone

CAT#: SC106135

AXIN2 (untagged)-Homo sapiens, Similar to axin 2 (conductin, axil), clone MGC:10366 IMAGE:4053244, complete cds

USD 474


Availability*
2 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Axin 2(AXIN2) (BC006295) Human Untagged Clone
Symbol AXIN2
Synonyms AXIL; DKFZp781B0869; MGC10366; MGC126582; conductin; axin 2
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for BC006295, the custom clone sequence may differ by one or more nucleotides


ATGAGTAGCGCTATGTTGGTGACTTGCCTCCCGGACCCCAGCAGCAGCTTCCGTGAGGATGCCCCGCGGC
CCCCAGTGCCAGGGGAAGAAGGGGAGACCCCACCGTGTCAGCCAGGGGTGGGCAAGGGCCAGGTCACCAA
ACCCATGCCTGTCTCTTCCAACACCAGGCGGAACGAAGATGGGTTGGGGGAGCCGGAGGGGCGGGCATCT
CCGGATTCCCCTCTGACCCGGTGGACCAAGTCCTTACACTCCTTATTGGGCGATCAAGACGGTGCTTACC
TGTTCCGAACTTTCCTGGAGAGGGAGAAATGCGTGGATACCTTAGACTTCTGGTTTGCCTGCAATGGATT
CAGGCAGATGAACCTGAAGGATACCAAAACTTTACGAGTAGCCAATGACTTTTGTCATGACATTTTGTTC
TACTTATACTGTAAATTATGCATTATAAAGAGTTCATTTAAGGAAAATTACTTGGTACAATAA


5' Read Nucleotide Sequence
>OriGene 5' read for BC006295 unedited
CAAATTTTGTATACGACTCATATAGGCGGCCGCGNAATTCGCACGAGGGGGAGGTCAGGG
NAAGACAGAGGTGTTGACTGAGCTGGATTCTTGGTGGGGAGAGGAGGTTCAGATGAGCCC
CTGCTGACTTGAGAGAGACAGAGAGACCACGCCGATTGCTGAGAGGAACTGGAAGAAGAA
AAATTCCCAGACTCAGTGGGAAGAGCTCCCTCACCATGAGTAGCGCTATGTTGGTGACTT
GCCTCCCGGACCCCAGCAGCAGCTTCCGTGAGGATGCCCCGCGGCCCCCAGTGCCAGGGG
AAGAAGGGGAGACCCCACCGTGTCAGCCAGGGGTGGGCAAGGGCCAGGTCACCAAACCCA
TGCCTGTCTCTTCCAACACCAGGCGGAACGAAGATGGGTTGGGGGAGCCGGAGGGGCGGG
CATCTCCGGATTCCCCTCTGACCCGGTGGACCAAGTCCTTACACTCCTTATTGGGCGATC
AAGACGGTGCTTACCTGTTCCGAACTTTCCTGGAGAGGGAGAAATGCGTGGATACCTTAG
ACTTCTGGTTTGCCTGCAATGGATTCAGGCAGATGAACCTGAAGGATACCAAAACTTTAC
GAGTAGCCAAAGCGATCTACANAAGGTACATTGAGAACAACAGCATTGTCTCCAAGCAGC
TGAAGCCTGCCACCAAGACCTACATAAGAGATGGCATCAAGAAGCAGCAGATTGATTCCA
TCATGTTTGACCANGCGCAGACCGAGATCCAGTCGGTGATGGGAGAAAATGCTACCAGAT
GTTNNTGACTTCTGATATATACCTCGAATATGTNGAGAGTGGGGGAGGAAACACAGCTTA
CATGNAGTATGGGGGACTCGGGAGCCTAANGGGTCGTGTGTGGCTATCTTCCCACCTTTG
GATGAGAANAAGGATGGNACTTGTGCCGACTTCAGTGCAAACTTTCGCAACCGTGGTGGC
TTGTCC
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN BC006295
ORF Size 483 bp
Insert Size 4000
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC006295.2, AAH06295
RefSeq Size 1041
RefSeq ORF 483
Locus ID 8313
Cytogenetics 17q24.1
Protein Families ES Cell Differentiation/IPS, Induced pluripotent stem cells, Druggable Genome
Protein Pathways Wnt signaling pathway, Pathways in cancer, Colorectal cancer, Endometrial cancer, Basal cell carcinoma
Gene Summary The Axin-related protein, Axin2, presumably plays an important role in the regulation of the stability of beta-catenin in the Wnt signaling pathway, like its rodent homologs, mouse conductin/rat axil. In mouse, conductin organizes a multiprotein complex of APC (adenomatous polyposis of the colon), beta-catenin, glycogen synthase kinase 3-beta, and conductin, which leads to the degradation of beta-catenin. Apparently, the deregulation of beta-catenin is an important event in the genesis of a number of malignancies. The AXIN2 gene has been mapped to 17q23-q24, a region that shows frequent loss of heterozygosity in breast cancer, neuroblastoma, and other tumors. Mutations in this gene have been associated with colorectal cancer with defective mismatch repair. [provided by RefSeq, Jul 2008].
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.