S6K1(RPS6KB1) (NM_003161) Human Untagged Clone

CAT#: SC105680

RPS6KB1 (untagged)-Human ribosomal protein S6 kinase, 70kDa, polypeptide 1 (RPS6KB1)

USD 835


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name S6K1(RPS6KB1) (NM_003161) Human Untagged Clone
Symbol RPS6KB1
Synonyms p70 S6KA; p70(S6K)-alpha; p70-alpha; p70-S6K; PS6K; S6K; S6K-beta-1; S6K1; STK14A
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>OriGene ORF sequence for NM_003161 edited
ATGAGGCGACGAAGGAGGCGGGACGGCTTTTACCCAGCCCCGGACTTCCGAGACAGGGAA
GCTGAGGACATGGCAGGAGTGTTTGACATAGACCTGGACCAGCCAGAGGACGCGGGCTCT
GAGGATGAGCTGGAGGAGGGGGGTCAGTTAAATGAAAGCATGGACCATGGGGGAGTTGGA
CCATATGAACTTGGCATGGAACATTGTGAGAAATTTGAAATCTCAGAAACTAGTGTGAAC
AGAGGGCCAGAAAAAATCAGACCAGAATGTTTTGAGCTACTTCGGGTACTTGGTAAAGGG
GGCTATGGAAAGGTTTTTCAAGTACGAAAAGTAACAGGAGCAAATACTGGGAAAATATTT
GCCATGAAGGTGCTTAAAAAGGCAATGATAGTAAGAAATGCTAAAGATACAGCTCATACA
AAAGCAGAACGGAATATTCTGGAGGAAGTAAAGCATCCCTTCATCGTGGATTTAATTTAT
GCCTTTCAGACTGGTGGAAAACTCTACCTCATCCTTGAGTATCTCAGTGGAGGAGAACTA
TTTATGCAGTTAGAAAGAGAGGGAATATTTATGGAAGACACTGCCTGCTTTTACTTGGCA
GAAATCTCCATGGCTTTGGGGCATTTACATCAAAAGGGGATCATCTACAGAGACCTGAAG
CCGGAGAATATCATGCTTAATCACCAAGGTCATGTGAAACTAACAGACTTTGGACTATGC
AAAGAATCTATTCATGATGGAACAGTCACACACACATTTTGTGGAACAATAGAATACATG
GCCCCTGAAATCTTGATGAGAAGTGGCCACAATCGTGCTGTGGATTGGTGGAGTTTGGGA
GCATTAATGTATGACATGCTGACTGGAGCACCCCCATTCACTGGGGAGAATAGAAAGAAA
ACAATTGACAAAATCCTCAAATGTAAACTCAATTTGCCTCCCTACCTCACACAAGAAGCC
AGAGATCTGCTTAAAAAGCTGCTGAAAAGAAATGCTGCTTCTCGTCTGGGAGCTGGTCCT
GGGGACGCTGGAGAAGTTCAAGCTCATCCATTCTTTAGACACATTAACTGGGAAGAACTT
CTGGCTCGAAAGGTGGAGCCCCCCTTTAAACCTCTGTTGCAATCTGAAGAGGATGTAAGT
CAGTTTGATTCCAAGTTTACACGTCAGACACCTGTCGACAGCCCAGATGACTCAACTCTC
AGTGAAAGTGCCAATCAGGTCTTTCTGGGTTTTACATATGTGGCTCCATCTGTACTTGAA
AGTGTGAAAGAAAAGTTTTCCTTTGAACCAAAAATCCGATCACCTCGAAGATTTATTGGC
AGCCCACGAACACCTGTCAGCCCAGTCAAATTTTCTCCTGGGGATTTCTGGGGAAGAGGT
GCTTCGGCCAGCACAGCAAATCCTCAGACACCTGTGGAATACCCAATGGAAACAAGTGGC
ATAGAGCAGATGGATGTGACAATGAGTGGGGAAGCATCGGCACCACTTCCAATACGACAG
CCGAACTCTGGGCCATACAAAAAACAAGCTTTTCCCATGATCTCCAAACGGCCAGAGCAC
CTGCGTATGAATCTATGA
5' Read Nucleotide Sequence
>OriGene 5' read for NM_003161 unedited
NGTCGGTTTTTGTATACGACTCCTATAGGCGGCCGCGNAATTCGCACGAGGCGGTGATGG
CGGCAGCGGCTGTGGTGGCTGCGGCGGGTCCGGGCCCATGAGGCGACGAAGGAGGCGGGA
CGGCTTTTACCCAGCCCCGGACTTCCGAGACAGGGAAGCTGAGGACATGGCAGGAGTGTT
TGACATAGACCTGGACCAGCCAGAGGACGCGGGCTCTGAGGATGAGCTGGAGGAGGGGGG
TCAGTTAAATGAAAGCATGGACCATGGGGGAGTTGGACCATATGAACTTGGCATGGAACA
TTGTGAGAAATTTGAAATCTCAGAAACTAGTGTGAACAGAGGGCCAGAAAAAATCAGACC
AGAATGTTTTGAGCTACTTCGGGTACTTGGTAAAGGGGGCTATGGAAAGGTTTTTCAAGT
ACGAAAAGTAACAGGAGCAAATACTGGGAAAATATTTGCCATGAAGGTGCTTAAAAAGGC
AATGATAGTAAGAAATGCTAAAGATACAGCTCATACAAAAGCAGAACGGAATATTCTGGA
GGAAGTAAAGCATCCCTTCATCGTGGATTTAATTTATGCCTTTCAGACTGGTGGAAAACT
CTACCTCATCCTTGAGTATCTCAGTGGAGGAGAACTATTTATGCAGTTAGAAAGAGAGGG
AATATTTATGGAAGACACTGCCTGCTTTTACTTGGCAGAAATCTCCATGGCTTTGGGGCA
TTTACATCANAAGGGGATCATCTACAGAGACCTGAAGCCGGAGAATATCATGCTTAATCA
CCAAGGTCATGTGAAACTAACAGACTTTGGACTATGCAAAGAATCTATTCATGATGGGAA
CAGTCACACACCCATTTNTGTGGAAACATAGAATACATGGCCCCTGAAATCTGATGAGAA
GTGCCACATCGTCTGGGATGNGGC
3' Read Nucleotide Sequence
>OriGene 3' read for NM_003161 unedited
NTTTTAGCTTGGNACCGCGGCCGCAATCTANGATCGAGTTTTTTTTTTTTTTTTTTTTTT
TTTCATTACAAATTGGCATTTAATTTCTATTTACATTCATTCAATCCGAAATCAAATAAT
ACAGTCAACTAAATACAAGATGAAAAGCAGAACAGGGGTTACCCTCATAGCACTCCTAAT
AAGGCAGCTGAAAAATTTTATTTACTGATAGATGCAAAGCGAACTTGGGATAGGAGAAAC
AATAGTTTAAAGAGCAAACACAAACATAGATGAACCCATCTTTCAAATGTTATTCCGGAT
AATCCACTGAGATAATACTTGGGCTATAATGTTAAAAATCACACAAGAAAAAGTCCTGTA
TTAATCAGCAACAGACCACAGGTTATGTGTGACAAATACTTTTGGGATAGTTTGCCCAGC
TTGCTAGGGTCTACTCCTATGAAAAAAGGTAAATGTTTGGACATTGATGTTTTTGAGAAA
TTAACCATTTTCAAAGCCTTAAAATCTATTCTTCATAAATTCAACATTTCTCATGGGAAT
AATCTTAGATCTAGCCCTTGTAAGCTAGGAACCATATGATTAACTGAATATTCAAAATAG
GTCCTATATTAAATATATAATCCAAGGCTCAGTATATTAATACTATCTAAGATGCATCTT
GTTTATAATCATTCATTACCTATAGTAAAGAATGTTGAATTTATGGAGTATCATACATGC
CTCCTCCACCCCTGCCCACAAATTATCTTTTATCTTAAAAAAAGTATGGAAAATCCTTCT
TGAGGATTCAATTAGTTAAGACCTAAAGGGGGAAAAGAACTAATTTTCCCTAAAATCGGG
TCAAAGTTCAATAATAAAACTTTACATGCTAATCACAGCTGGTTTATAAACCCAGCTAAG
TATTCTGGATG
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_003161
ORF Size 1578 bp
Insert Size 5100
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_003161.2, NP_003152
RefSeq Size 5332
RefSeq ORF 1578
Locus ID 6198
Cytogenetics 17q23.1
Domains pkinase, pkinase_C, TyrKc, S_TKc
Protein Families Protein Kinase, Druggable Genome
Protein Pathways ErbB signaling pathway, mTOR signaling pathway, TGF-beta signaling pathway, Fc gamma R-mediated phagocytosis, Insulin signaling pathway, Acute myeloid leukemia
Gene Summary This gene encodes a member of the ribosomal S6 kinase family of serine/threonine kinases. The encoded protein responds to mTOR (mammalian target of rapamycin) signaling to promote protein synthesis, cell growth, and cell proliferation. Activity of this gene has been associated with human cancer. Alternatively spliced transcript variants have been observed. The use of alternative translation start sites results in isoforms with longer or shorter N-termini which may differ in their subcellular localizations. There are two pseudogenes for this gene on chromosome 17. [provided by RefSeq, Jan 2013].
Transcript Variant: This variant (1) can initiate translation from two alternate in-frame AUG start codons. The isoform represented in this RefSeq (a, also known as p85 or alpha I) is derived from the first AUG start codon, and is the longest isoform.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.