S6K1 (RPS6KB1) (NM_003161) Human Untagged Clone

CAT#: SC323348

RPS6KB1 (untagged)-Kinase deficient mutant (K123M) of Human ribosomal protein S6 kinase, 70kDa, polypeptide 1 (RPS6KB1)


  "NM_003161" in other vectors (8)

Reconstitution Protocol

USD 783.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
RPS6KB1 (S6K) mouse monoclonal antibody, clone OTI1G4 (formerly 1G4)
    • 100 ul

USD 447.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "S6K1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol S6K1
Synonyms p70 S6KA; p70(S6K)-alpha; p70-alpha; p70-S6K; PS6K; S6K; S6K-beta-1; S6K1; STK14A
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC323348 representing NM_003161.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAGGCGACGAAGGAGGCGGGACGGCTTTTACCCAGCCCCGGACTTCCGAGACAGGGAAGCTGAGGAC
ATGGCAGGAGTGTTTGACATAGACCTGGACCAGCCAGAGGACGCGGGCTCTGAGGATGAGCTGGAGGAG
GGGGGTCAGTTAAATGAAAGCATGGACCATGGGGGAGTTGGACCATATGAACTTGGCATGGAACATTGT
GAGAAATTTGAAATCTCAGAAACTAGTGTGAACAGAGGGCCAGAAAAAATCAGACCAGAATGTTTTGAG
CTACTTCGGGTACTTGGTAAAGGGGGCTATGGAAAGGTTTTTCAAGTACGAAAAGTAACAGGAGCAAAT
ACTGGGAAAATATTTGCCATGAAGGTGCTTAAAAAGGCAATGATAGTAAGAAATGCTAAAGATACAGCT
CATACAAAAGCAGAACGGAATATTCTGGAGGAAGTAAAGCATCCCTTCATCGTGGATTTAATTTATGCC
TTTCAGACTGGTGGAAAACTCTACCTCATCCTTGAGTATCTCAGTGGAGGAGAACTATTTATGCAGTTA
GAAAGAGAGGGAATATTTATGGAAGACACTGCCTGCTTTTACTTGGCAGAAATCTCCATGGCTTTGGGG
CATTTACATCAAAAGGGGATCATCTACAGAGACCTGAAGCCGGAGAATATCATGCTTAATCACCAAGGT
CATGTGAAACTAACAGACTTTGGACTATGCAAAGAATCTATTCATGATGGAACAGTCACACACACATTT
TGTGGAACAATAGAATACATGGCCCCTGAAATCTTGATGAGAAGTGGCCACAATCGTGCTGTGGATTGG
TGGAGTTTGGGAGCATTAATGTATGACATGCTGACTGGAGCACCCCCATTCACTGGGGAGAATAGAAAG
AAAACAATTGACAAAATCCTCAAATGTAAACTCAATTTGCCTCCCTACCTCACACAAGAAGCCAGAGAT
CTGCTTAAAAAGCTGCTGAAAAGAAATGCTGCTTCTCGTCTGGGAGCTGGTCCTGGGGACGCTGGAGAA
GTTCAAGCTCATCCATTCTTTAGACACATTAACTGGGAAGAACTTCTGGCTCGAAAGGTGGAGCCCCCC
TTTAAACCTCTGTTGCAATCTGAAGAGGATGTAAGTCAGTTTGATTCCAAGTTTACACGTCAGACACCT
GTCGACAGCCCAGATGACTCAACTCTCAGTGAAAGTGCCAATCAGGTCTTTCTGGGTTTTACATATGTG
GCTCCATCTGTACTTGAAAGTGTGAAAGAAAAGTTTTCCTTTGAACCAAAAATCCGATCACCTCGAAGA
TTTATTGGCAGCCCACGAACACCTGTCAGCCCAGTCAAATTTTCTCCTGGGGATTTCTGGGGAAGAGGT
GCTTCGGCCAGCACAGCAAATCCTCAGACACCTGTGGAATACCCAATGGAAACAAGTGGCATAGAGCAG
ATGGATGTGACAATGAGTGGGGAAGCATCGGCACCACTTCCAATACGACAGCCGAACTCTGGGCCATAC
AAAAAACAAGCTTTTCCCATGATCTCCAAACGGCCAGAGCACCTGCGTATGAATCTATGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_003161
Insert Size 1578 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_003161.3
RefSeq Size 5368 bp
RefSeq ORF 1578 bp
Locus ID 6198
UniProt ID P23443
Cytogenetics 17q23.1
Domains pkinase, S_TK_X, TyrKc, S_TKc
Protein Families Druggable Genome, Protein Kinase
Protein Pathways Acute myeloid leukemia, ErbB signaling pathway, Fc gamma R-mediated phagocytosis, Insulin signaling pathway, mTOR signaling pathway, TGF-beta signaling pathway
MW 59.1 kDa
Gene Summary This gene encodes a member of the ribosomal S6 kinase family of serine/threonine kinases. The encoded protein responds to mTOR (mammalian target of rapamycin) signaling to promote protein synthesis, cell growth, and cell proliferation. Activity of this gene has been associated with human cancer. Alternatively spliced transcript variants have been observed. The use of alternative translation start sites results in isoforms with longer or shorter N-termini which may differ in their subcellular localizations. There are two pseudogenes for this gene on chromosome 17. [provided by RefSeq, Jan 2013]
Transcript Variant: This variant (1) can initiate translation from two alternate in-frame AUG start codons. The isoform represented in this RefSeq (a, also known as p85 or alpha I) is derived from the first AUG start codon, and is the longest isoform. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.