Cytochrome C(CYCS) (XM_172188) Human Untagged Clone

CAT#: SC103097

(untagged)-Human similar to hypothetical protein DKFZp434G1735.1 - Human (fragment) (LOC255468)

USD 618


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Cytochrome C(CYCS) (XM_172188) Human Untagged Clone
Symbol CYCS
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for XM_172188, the custom clone sequence may differ by one or more nucleotides


ATGGGTGATGTTGAGAAAGGCAAGAAGATTTTTATTATGAAGTGTTCCCAGTGCCACACCGTTGAAAAGG
GAGGCAAGCACAAGACTGGGCCAAATCTCCAAGGCCTCTTCGGGCGGAAGACAGGTCAGGCCGCTGGATA
CTCTTACACGGTTGCCAGTAAGAACAAAGGCATCACCTGGGGAGAGGATACACTGATGGAGTATTTGGAG
AATCCCAAGAAGCACATACCTGAAACAAAAATGATCTTTGTCGGCATTAAGAAGAAGGAAGAAAGGGCAG
ACTCGATAGCTTTTCTCAAAAAAGCTACTAATGAGTAA


5' Read Nucleotide Sequence
>OriGene 5' read for XM_172188 unedited
GGGGTACAAATTTTGTAATACGACTCACTATACGTGCGGCCGCGAATTCGCACGAGGGGA
CGTCCGGCTTCGGAGCGGGAGTGTTCGTTGTGCCAGCGACTAAAAAGAGAATTAAATATG
GGTGATGTTGAGAAAGGCAAGAAGATTTTTATTATGAAGTGTTCCCAGTGCCACACCGTT
GAAAAGGGAGGCAAGCACAAGACTGGGCCAAATCTCCATGGTCTCTTTGGGCGGAAGACA
GGTCAGGCCCCTGGATACTCTTACACAGCCGCCAATAAGAACAAAGGCATCATCTGGGGA
GAGGATACACTGATGGAGTATTTGGAGAATCCCAAGAAGTACATCCCTGGAACAAAAATG
ATCTTTGTCGGCATTAAGAAGAAGGAAGAAAGGGCAGACTTAATAGCTTATCTCAAAAAA
GCTACTAATGAGTAATAATTGGCCACTGCCTTATTTATTACAAAACAGAAATGTCTCATG
ACTTTTTTATGTGTACCATCCTTTAATAGATCTCATACACCAGAATTCAGATCATGAATG
ACTGACAGAATATTTTGTTGGGCAGTCCTGATTTAAAACTAAGACTGGCTTGTGGTTAAA
TGAATATGTTCAGTTTTTGAATTTTAATAGTAACTCCAATTCAGTAAATGGTATCACTGT
TTACCCCTTTTAAAGATATGATTAGACTTCGTTAGTAATGTTCAACTTTTCACAAAGATG
GTGAGTGCCATCTTAAAACTTACTGGAGATTGGTTTTATATTTAGATNTATATAACTGGT
TATGTGAATATATNTAAATACTNGGGGAAATTGCTTCACTGTCTTAGAAACCAAGCAGAT
CACCTGTGNTTTGNGNTCATGNTCATTTGCCTCTTAAGGCAGGGNNTGAGATAAATAGGT
AGCATGTCTATAGTTTTGGCTTACTTGCC
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN XM_172188
ORF Size 318 bp
Insert Size 1350
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq Size 318
RefSeq ORF 318
Locus ID 54205
Cytogenetics 7p15.3
Domains cytochrome_c
Protein Families Druggable Genome
Protein Pathways p53 signaling pathway, Apoptosis, Alzheimer's disease, Parkinson's disease, Amyotrophic lateral sclerosis (ALS), Huntington's disease, Pathways in cancer, Colorectal cancer, Small cell lung cancer, Viral myocarditis
Gene Summary This gene encodes a small heme protein that functions as a central component of the electron transport chain in mitochondria. The encoded protein associates with the inner membrane of the mitochondrion where it accepts electrons from cytochrome b and transfers them to the cytochrome oxidase complex. This protein is also involved in initiation of apoptosis. Mutations in this gene are associated with autosomal dominant nonsyndromic thrombocytopenia. Numerous processed pseudogenes of this gene are found throughout the human genome.[provided by RefSeq, Jul 2010].
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.