SOS2 (XM_043720) Human Untagged Clone

CAT#: SC102657

SOS2 (untagged)-Human son of sevenless homolog 2 (Drosophila) (SOS2)

USD 618.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name SOS2 (XM_043720) Human Untagged Clone
Symbol SOS2
Synonyms FLJ25596; guanine nucleotide exchange factor; guanine nucleotide releasing factor; son of sevenless homolog 2; son of sevenless homolog 2 (Drosophila)
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for XM_043720, the custom clone sequence may differ by one or more nucleotides


ATGCAGCAGGCGCCGCAGCCTTACGAGTTCTTCAGCGAGGAGAACAGTCCGAAATGGCGGGGACTGTTGG
TCTCGGCCCTGCGGAAGGTTCAGGAACAAGTGCATCCCACTCTCTCAGCTAATGAAGAGTCTCTCTATTA
TATTGAAGAGCTGATTTTTCAGCTGCTTAATAAATTATGCATGGCCCAGCCAAGGACTGTTCAAGATGTA
GAGGAGCGAGTTCAGAAGACCTTTCCTCACCCAATTGATAAATGGGCCATTGCTGATGCACAATCTGCTA
TAGAAAAACGAAAACGAAGAAATCCTCTTTTACTGCCTGTGGACAAAATCCATCCTTCGTTGAAGGAAGT
ATTAGGGTACAAAGTGGACTACCATGTATCCCTATATATTGTGGCTGTACTAGAGTATATCTCAGCTGAT
ATTTTAAAATTGGCTGGTAATTATGTTTTTAATATCCGGCATTATGAAATATCTCAGCAGGACATTAAAG
TGTCAATGTGTGCGGATAAGGTTTTGATGGACATGTTTGATCAGGATGACATAGGTTTGGTTTCTCTCTG
TGAAGATGAACCTAGTTCTTCTGGTGAATTAAACTACTATGATCTTGTCAGAACTGAAATCGCAGAAGAA
AGACAGTATCTACGGGAATTAAATATGATCATAAAAGTGTTTCGAGAAGCCTTTCTTTCTGATAGAAAGC
TGTTTAAACCTTCTGATATCGAAAAGATTTTTAGTAACATTTCAGATATACATGAATTGACTGTGAAACT
TTTAGGTTTGATTGAAGACACAGTTGAAATGACTGATGAAAGCAGTCCTCATCCCTTAGCTGGCAGCTGT
TTTGAAGATTTGGCAGAAGAGCAAGCATTTGATCCTTATGAAACATTATCACAGGACATTCTTTCACCAG
AGTTTCATGAACATTTCAATAAATTGATGGCCAGACCTGCAGTTGCTCTACACTTTCAGTCCATTGCTGA
TGGTTTTAAAGAGGCAGTTCGTTATGTCCTTCCACGTCTTATGCTGGTGCCAGTGTATCACTGTTGGCAC
TACTTTGAGTTACTAAAGCAATTGAAAGCATGTAGTGAAGAACAAGAAGACAGAGAATGTTTGAACCAAG
CTATTACTGCTCTCATGAATCTCCAAGGTAGCATGGACCGAATTTACAAGCAGTATTCACCTAGACGTCG
ACCTGGAGATCCTGTTTGCCCTTTTTATAGTCACCAATTAAGAAGCAAACACCTGGCTATCAAAAAAATG
AATGAAATTCAGAAAAATATCGATGGATGGGAAGGCAAAGATATTGGACAGTGTTGTAATGAATTCATTA
TGGAGGGACCATTGACAAGAATCGGTGCCAAACATGAACGGCATATTTTTCTGTTTGATGGCTTAATGAT
CAGTTGTAAACCTAATCATGGCCAGACTCGGCTTCCAGGTTACAGTAGTGCAGAATACAGGTTAAAAGAA
AAATTTGTCATGAGGAAAATACAAATTTGTGATAAAGAAGATACTTGTGAGCACAAGCATGCATTTGAAT
TAGTATCCAAAGATGAGAACAGCATAATATTTGCTGCTAAGTCTGCTGAAGAAAAAAACAACTGGATGGC
AGCCCTTATTTCTCTTCATTATCGTAGTACTCTAGATCGAATGTTAGATTCAGTATTATTGAAAGAAGAA
AATGAGCAACCACTGAGATTACCAAGTCCTGAAGTATATCGTTTTGTAGTAAAAGACTCTGAGGAAAACA
TTGTTTTTGAAGACAACTTGCAAAGTAGAAGTGGCATCCCCATTATTAAAGGAGGAACTGTAGTGAAATT
AATTGAAAGGTTAACATATCATATGTATGCAGATCCCAATTTTGTTCGTACTTTTCTTACCACATATCGT
TCATTTTGTAAACCACAGGAATTGCTGAGCTTACTGATTGAACGGTTTGAAATTCCAGAGCCAGAACCTA
CTGACGCAGACAAATTGGCAATAGAGAAAGGCGAGCAGCCAATCAGTGCAGACCTTAAAAGATTTCGCAA
GGAATATGTCCAACCAGTACAACTTAGGATCTTAAATGTATTTCGGCATTGGGTTGAACATCATTTTTAT
GACTTTGAAAGAGACTTGGAATTGCTTGAAAGACTAGAATCCTTCATTTCAAGTGTAAGAGGGAAAGCTA
TGAAAAAATGGGTAGAGTCAATTGCTAAGATCATCAGGAGGAAGAAGCAAGCTCAGGCAAACGGAGTAAG
CCATAATATTACCTTTGAAAGTCCACCTCCACCAATTGAATGGCATATCAGCAAACCAGGACAGTTTGAA
ACATTTGATCTCATGACACTTCATCCAATAGAAATTGCACGTCAGCTGACACTTTTGGAGTCTGATCTTT
ACAGGAAAGTTCAACCGTCTGAACTTGTAGGGAGTGTGTGGACCAAAGAAGATAAAGAAATAAATTCTCC
AAATTTATTAAAAATGATTCGCCATACCACAAATCTCACCCTCTGGTTTGAAAAATGCATTGTGGAAGCA
GAAAATTTTGAAGAACGGGTGGCAGTACTAAGTAGAATTATAGAAATTCTGCAAGTTTTTCAAGATTTGA
ATAATTTCAATGGCGTATTGGAGATAGTCAGTGCAGTAAATTCAGTGTCAGTATACAGACTAGACCATAC
CTTTGAGGCACTGCAGGAAAGGAAAAGGAAAATTTTGGACGAAGCTGTGGAATTAAGTCAAGATCACTTT
AAAAAATACCTAGTAAAACTTAAGTCAATCAATCCACCTTGTGTGCCTTTTTTTGGAATATATTTAACAA
ATATTCTGAAGACCGAAGAAGGGAATAATGATTTTTTAAAAAAGAAAGGGAAAGATTTAATCAATTTCAG
TAAGAGGAGGAAAGTAGCTGAAATTACTGGAGAAATTCAGCAGTATCAGAATCAGCCTTACTGTTTACGG
ATAGAACCAGATATGAGGAGATTCTTTGAAAACCTTAACCCCATGGGAAGTGCATCTGAAAAAGAGTTTA
CAGATTATTTGTTCAACAAGTCACTAGAAATTGAACCTCGAAACTGCAAACAGCCACCTCGATTTCCTAG
GAAATCAACTTTTTCCTTAAAATCTCCTGGAATAAGGCCTAACACAGGCCGACATGGCTCTACCTCAGGT
ACTTTACGAGGTCACCCAACACCATTAGAAAGAGAACCATGTAAAATAAGCTTTAGTCGGATTGCTGAAA
CTGAGCTGGAATCAACAGTGTCAGCACCAACCTCTCCAAATACACCATCTACTCCACCAGTATCTGCTTC
TTCAGACCTTAGTGTATTTTTAGATGTGGATCTCAACAGCTCCTGTGGCAGCAATAGCATCTTTGCTCCA
GTGCTTTTGCCACATTCAAAGTCTTTCTTTAGTTCATGTGGTAGTTTACATAAACTAAGTGAAGAGCCCC
TGATTCCTCCTCCTCTTCCTCCTCGAAAAAAGTTTGATCATGATGCTTCAAATTCCAAGGGAAATATGAA
ATCTGATGATGATCCTCCTGCTATTCCACCGAGACAGCCTCCTCCTCCAAAGGTAAAACCCAGAGTTCCT
GTTCCTACTGGTGCATTTGATGGGCCTCTGCATAGTCCACCTCCGCCACCACCAAGAGATCCTCTTCCTG
ATACCCCTCCACCAGTTCCCCTTCGGCCTCCAGAACACTTTATAAACTGTCCATTTAATCTTCAGCCACC
TCCACTGGGGCATCTTCACAGAGATTCAGACTGGCTCAGAGACATTAGTACGTGTCCAAATTCGCCAAGC
ACTCCTCCTAGCACACCCTCTCCAAGGGTACCGCGTCGATGCTATGTGCTCAGTTCTAGTCAGAATAATC
TTGCTCATCCTCCAGCTCCCCCTGTTCCACCAAGGCAGAATTCAAGCCCTCATCTGCCAAAACTGCCACC
AAAGACTTACAAACGGGAGCTTTCGCACCCCCCATTGTACAGACTGCCTTTGCTAGAAAATGCAGAAACT
CCCCAATGA


5' Read Nucleotide Sequence
>OriGene 5' read for XM_043720 unedited
NGGTTCAGAATTGTATACGACTCATATAGGCGGTCCGCGAATTCGCACGAGGAATCAGTG
CAGACCTTAAAAGATTCGCAAGGAATTGTCCAACCAGTACAACTTAGGATCTTAAATGTA
TTTCGGCATTGGGTTGAACATCATTTTTATGACTTTGAAAGAGACTTGGAATTGCTTGAA
AGACTAGAATCCTTCATTTCAAGTGTAAGAGGGAAAGCTATGAAAAAAGGGTAGAGTCAA
TTGCTAAGATCATCAGGAGGAAGAAGCAAGCTCAGGCAAATGGAGTAAGCCATAATATTA
CCTTTGAAAGTCCACCTCCACCAATTGAATGGCATATCAGCAAACCAGGACAGTTTGAAA
CATTTGATCTCATGACACTTCATCCAATAGAAATTGCACGTCAGCTGACACTTTTGGAGT
CTGATCTTTACAGGAAAGTTCAACCGTCTGAACTTGTAGGGAGTGTGTGGACCAAAGAAG
ATAAAGAAATAAATTCTCCAAATTTATTAAAAATGATTCGCCATACCACAAATCTCACCC
TCTGGTTTGAAAAATGCATTGTGGAAGCAGAAAATTTTGAAGAACGGGTGGCAGTACTAA
GTAGAATTATAGAAATTCTGCAAGTTTTTCAAGATTTGAATAATTTCAATGGCGTATTGG
AGATAGTCAGTGCAGTAAATTCAGTGTCAGTATACAGACTAGACCATACCTTNTGAGCAC
TGCANGAAAGGAAAAGGGAAATTTGGACGAAGCTGTGGAATTAAGTCAAGATCACTTTAA
AAAATACCTAGTAAAACTTAAGTCAATCAATCCACCCTGTGTGGCCTTTTTTGGAAATAT
ATTTACAAATATTCTGAAGACCCAGAAGGGAATATGATTTTTTAAAAAGAAAGGGAAGAT
TTATCATTTCAGTAGAAGAGA
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN XM_043720
ORF Size 3894 bp
Insert Size 3500
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq Size 5313
Locus ID 6655
Cytogenetics 14q21.3
Domains RasGEF
Protein Pathways MAPK signaling pathway, ErbB signaling pathway, Chemokine signaling pathway, Dorso-ventral axis formation, Focal adhesion, Gap junction, Jak-STAT signaling pathway, Natural killer cell mediated cytotoxicity, T cell receptor signaling pathway, B cell receptor signaling pathway, Fc epsilon RI signaling pathway, Neurotrophin signaling pathway, Regulation of actin cytoskeleton, Insulin signaling pathway, GnRH signaling pathway, Pathways in cancer, Colorectal cancer, Renal cell carcinoma, Endometrial cancer, Glioma, Prostate cancer, Chronic myeloid leukemia, Acute myeloid leukemia, Non-small cell lung cancer
Gene Summary This gene encodes a regulatory protein that is involved in the positive regulation of ras proteins. Mutations in this gene are associated with Noonan Syndrome-9. [provided by RefSeq, Jul 2016]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.