Rbmx (NM_001025663) Rat Untagged Clone

CAT#: RN209936

Rbmx (untagged ORF) - Rat RNA binding motif protein, X-linked (Rbmx), (10 ug)


  "NM_001025663" in other vectors (3)

Reconstitution Protocol

USD 503.00

5 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Rbmx"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Rbmx
Synonyms hnRNP-G; hnRNP G
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN209936 representing NM_001025663
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGTTGAAGCAGATCGCCCAGGAAAGCTCTTTATTGGTGGGCTTAATACAGAAACAAATGAGAAAGCCC
TGGAGGCAGTGTTTGGCAAATATGGACGAATAGTGGAAGTGCTTTTGATGAAGGACCGAGAAACCAATAA
GTCAAGAGGATTTGCTTTTGTCACATTTGAAAGCCCAGCAGATGCAAAGGATGCTGCCAGAGACATGAAT
GGAAAGTCCTTAGATGGAAAAGCCATCAAGGTGGAGCAAGCCACCAAACCATCATTTGAAAGTGGCAGAC
GTGGACTACCTCCACCTCCAAGAAGCAGAGGCCCTCCCAGAGGTCTTCGAGGAGGAAGAGGGGGAAGTGG
AGGAACCAGAGGACCCCCATCACGGGGAGGACACATGGATGATGGTGGCTACTCCATGAATTTTACTTTG
AGTTCTTCCAGAGGACCTCTTCCAGTAAAAAGAGGACCACCACCAAGAAGTGGAGGTCCTCCTCCTAAAA
GATCAGCACCTTCAGGACCAGTTCGCAGCAGCAGTGGAATGGGAGGAAGAGCTCCTGTGTCACGTGGAAG
AGATGGTTATGGAGGCCCACCACGAAGAGAGCCCCTGCCTTCTCGTAGAGATGTTTATTTGTCCCCGAGA
GATGATGGATATTCCACTAAAGACAGCTATTCAAGCAGAGACTATCCAAGTTCTCGAGATACACGAGATT
ATGCACCACCACCAAGAGATTATACTTACCGTGATTATGGTCATTCCAGTTCACGAGATGACTATCCATC
AAGAGGCTATAGTGATAGAGATGGATATGGTCGGGAGCGTGACTATTCGGATCATCCAAGTGGAGGTTCC
TACAGAGATTCGTATGAGAGTTATGGTAACTCACGTAGTGCTCCACCTACACGAGGGCCCCCGCCATCTT
ATGGTGGAAGCAGTCGCTATGATGATTACAGCAGCTCACGTGACGGATATGGTGGAAGTCGAGACAGTTA
CACAAGCAGCCGAAGTGATCTCTACTCAAGTGGTCGTGATCGCGTGGGCAGACAAGAACGAGGGCTTCCC
CCTTCTATGGAAAGGGGGTACCCTCCTCCACGTGATTCCTACAGCAGTTCAAGCCGCGGAGCACCAAGAG
GTGGTGGCCGTGGAGGAAGCCGATCTGATAGAGGGGGCAGAAGCAGATACTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001025663
Insert Size 1173 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001025663.1, NP_001020834.1
RefSeq Size 2042 bp
RefSeq ORF 1173 bp
Locus ID 302855
UniProt ID Q4V898
Cytogenetics Xq37
Gene Summary RNA-binding protein that plays several role in the regulation of pre- and post-transcriptional processes. Implicated in tissue-specific regulation of gene transcription and alternative splicing of several pre-mRNAs. Binds to and stimulates transcription from the tumor suppressor TXNIP gene promoter; may thus be involved in tumor suppression. When associated with SAFB, binds to and stimulates transcription from the SREBF1 promoter. Associates with nascent mRNAs transcribed by RNA polymerase II. Component of the supraspliceosome complex that regulates pre-mRNA alternative splice site selection. Can either activate or suppress exon inclusion; acts additively with TRA2B to promote exon 7 inclusion of the survival motor neuron SMN. Represses the splicing of MAPT/Tau exon 10. Binds preferentially to single-stranded 5'-CC[A/C]-rich RNA sequence motifs localized in a single-stranded conformation; probably binds RNA as a homodimer. Binds non-specifically to pre-mRNAs. Plays also a role in the cytoplasmic TNFR1 trafficking pathways; promotes both the IL-1-beta-mediated inducible proteolytic cleavage of TNFR1 ectodomains and the release of TNFR1 exosome-like vesicles to the extracellular compartment.[UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.