Pold2 (NM_001013050) Rat Untagged Clone

CAT#: RN207452

Pold2 (untagged ORF) - Rat polymerase (DNA directed), delta 2, regulatory subunit (Pold2), (10 ug)


  "NM_001013050" in other vectors (3)

Reconstitution Protocol

USD 503.00

5 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Pold2"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Pold2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN207452 representing NM_001013050
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTTTTCAGAGCAGGCAGCACAGAGGGCCCACACTCTGCTCTCCCCGCCATCAGCCAGCAATGCCACCT
TTGCCCGGGTGCCTGTGGCCACGTACACCAACTCCTCACAGCCCTTCCGACTGGGAGAGCGCAGCTTTAA
CCGACAGTACGCCCATATTTATGCCACACGCCTTATCCAGATGAGACCCTTCCTGGTGAGCCGGGCGCAG
CAGCACTGGGGCAGCCAAGTTGAAGTGAAGAAGTTGTGTGAGCTGCAGCCCGGGGAGCAGTGCTGTGTGG
TGGGCACGCTGTTCAAAGCCATGCCTCTCCAACCCTCCATCCTGCGGGAAATCAGCGAGGAGCACAACCT
GATCCCCCAGCCGCCTCGGAGCAAATACATCCACCCAGATGACGAACTGGTCTTAGAAGATGAATTGCAG
CGTATCAAACTGAAGGGCACCATCGATGTGTCAAAGTTGGTCACAGGAACGGTCTTGGCTGTGTTTGGCT
CTGTGAAGGATGACGGTAAGTTTCAGGTTGAGGACCACTGCTTTGCTGACCTGGCTCCACAGAATCCTGT
GCCCCCACTTGACACAGACAGATTTGTGCTACTGGTGTCCGGACTGGGCCTGGGCGGCGGTGGCGGGGAG
AGCCTCCTGGGCACGCAGCTGCTGGTAGACGTGGTGACGGGACAGCTTGGGGACGAAGGGGAGCAGTGCA
GTGCTGCCCACGTCTCTCGAGTCATCCTTGCAGGCAACCTCCTCAGTCATAACACCCAGAGCCGAGATTC
CATCAATAAGGCCAAATACCTCACCAAGAAAACCCAGGCAGCCAGTGTGGAGGCAGTCAAAATGCTGGAC
GAGATCCTACTGCAACTCAGCGCCTCAGTACCCGTGGATGTGATGCCGGGAGAATTTGATCCAACCAACT
ATACGCTCCCACAGCAGCCCCTGCACCCCTGCATGTTCCCCCTGGCCACTGCCTACGCCACACTCCAGCT
GGTCACCAACCCATACCAAGCCACTATTGACGGAGTAAGGTTCCTGGGGACATCTGGGCAGAACGTGAGC
GATATCTTCCGGTATAGCAGCATGGAGGACCATTTAGAGATCCTAGAGTGGACCCTGCGAGTCCGTCACA
TCAGCCCCACGGCCCCAGACACCCTAGGGTGCTACCCCTTCTACAAAACCGACCCATTCATCTTTGCGGA
ATGCCCTCACGTCTACTTCTGCGGCAACACTCCCAGCTTTGGCTCTAAAGTCATCCGAGGTCCTGAGGAC
CAGGCCGTGCTGTTGGTGGCCGTTCCTGACTTCAGTTCCACACAGACAGCCTGCCTGGTGAACCTGCGTG
GCCTGACCTGCCAGCCTATCAGCTTTGCAGGATTTGGGGCAGAGCAAGACGACCTAGAAGACCTGGGGCT
GGGTCCCTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001013050
Insert Size 1410 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001013050.1, NP_001013068.1
RefSeq Size 1585 bp
RefSeq ORF 1410 bp
Locus ID 289758
UniProt ID Q6AXY4
Cytogenetics 14q21
Gene Summary As a component of the trimeric and tetrameric DNA polymerase delta complexes (Pol-delta3 and Pol-delta4, respectively), plays a role in high fidelity genome replication, including in lagging strand synthesis, and repair. Pol-delta3 and Pol-delta4 are characterized by the absence or the presence of POLD4. They exhibit differences in catalytic activity. Most notably, Pol-delta3 shows higher proofreading activity than Pol-delta4. Although both Pol-delta3 and Pol-delta4 process Okazaki fragments in vitro, Pol-delta3 may also be better suited to fulfill this task, exhibiting near-absence of strand displacement activity compared to Pol-delta4 and stalling on encounter with the 5'-blocking oligonucleotides. Pol-delta3 idling process may avoid the formation of a gap, while maintaining a nick that can be readily ligated. Along with DNA polymerase kappa, DNA polymerase delta carries out approximately half of nucleotide excision repair (NER) synthesis following UV irradiation. Under conditions of DNA replication stress, required for the repair of broken replication forks through break-induced replication (BIR). Involved in the translesion synthesis (TLS) of templates carrying O6-methylguanine or abasic sites performed by Pol-delta4, independently of DNA polymerase zeta (REV3L) or eta (POLH). Facilitates abasic site bypass by DNA polymerase delta by promoting extension from the nucleotide inserted opposite the lesion. Also involved in TLS as a component of the POLZ complex. Along with POLD3, dramatically increases the efficiency and processivity of DNA synthesis of the minimal DNA polymerase zeta complex, consisting of only REV3L and REV7.[UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.