Igf1 (NM_178866) Rat Untagged Clone
CAT#: RN200511
Igf1 (untagged ORF) - Rat insulin-like growth factor 1 (Igf1), transcript variant 2, (10 ug)
"NM_178866" in other vectors (3)
Product Images
Specifications
Product Data | |
Type | Rat Untagged Clone |
Tag | Tag Free |
Symbol | Igf1 |
Synonyms | IGF |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>RN200511 representing NM_178866
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGAGCGCACCTCCAATAAAGATACACATCATGTCGTCTTCACATCTCTTCTACCTGGCACTCTGCTTGC TCACCTTTACCAGCTCGGCCACAGCCGGACCAGAGACCCTTTGCGGGGCTGAGCTGGTGGACGCTCTTCA GTTCGTGTGTGGACCAAGGGGCTTTTACTTCAACAAGCCCACAGGCTATGGCTCCAGCATTCGGAGGGCA CCACAGACGGGCATTGTGGATGAGTGTTGCTTCCGGAGCTGTGATCTGAGGAGGCTGGAGATGTACTGTG CTCCGCTGAAGCCTACAAAGTCAGCTCGTTCCATCCGGGCCCAGCGCCACACTGACATGCCCAAGACTCA GAAGGAAGTACACTTGAAGAACACAAGTAGAGGAAGTGCAGGAAACAAGACCTACAGAATGTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Chromatograms |
CHROMATOGRAMS
Sequencher program is needed, download here. |
Restriction Sites | SgfI-MluI |
ACCN | NM_178866 |
Insert Size | 414 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_178866.4, NP_849197.3 |
RefSeq Size | 1530 bp |
RefSeq ORF | 414 bp |
Locus ID | 24482 |
Cytogenetics | 7q13 |
Gene Summary | growth factor; plays a major role in mammalian growth [RGD, Feb 2006] Transcript Variant: This variant (2) differs in the 5' UTR and has multiple coding region differences which include the absence of an alternate frame-shifting exon, compared to variant 3. These differences cause translation initiation from a distinct start codon and result in an isoform (b) with novel N- and C-termini, compared to isoform c. This isoform is also known as IIA. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RR200511 | Igf1 (Myc-DDK-tagged ORF) - Rat insulin-like growth factor 1 (Igf1), transcript variant 2, (10 ug) |
USD 240.00 |
|
RR200511L3 | Lenti ORF clone of Igf1 (Myc-DDK-tagged ORF) - Rat insulin-like growth factor 1 (Igf1), transcript variant 2, (10 ug) |
USD 540.00 |
|
RR200511L4 | Lenti ORF clone of Igf1 (mGFP-tagged ORF) - Rat insulin-like growth factor 1 (Igf1), transcript variant 2, (10 ug) |
USD 540.00 |
{0} Product Review(s)
Be the first one to submit a review