Daxx (NM_001199733) Mouse Untagged Clone

CAT#: MC228821

Daxx (untagged) - Mouse Fas death domain-associated protein (Daxx), transcript variant 1


  "NM_001199733" in other vectors (1)

Reconstitution Protocol

USD 746.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
DAXX Antibody - C-terminal region
    • 100 ul

USD 539.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Daxx"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Daxx
Synonyms MGC150289
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC228821 representing NM_001199733
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCCACCGATGACAGCATCATTGTACTTGATGATGACGATGAAGATGAAGCTGCTGCTCAACCAGGGC
CCTCCAACCTACCCCCCAATCCTGCCTCAACAGGACCTGGTCCTGGCCTGTCTCAACAGGCCACTGGTCT
CTCCGAGCCCCGTGTGGATGGAGGGAGCAGTAACTCCGGTAGTAGGAAGTGCTACAAGTTGGATAATGAG
AAGCTCTTTGAAGAGTTCCTTGAACTGTGTAAGACGGAGACATCAGACCACCCTGAGGTGGTTCCGTTCC
TCCACAAACTGCAGCAGCGTGCCCAGTCTGTGTTTCTGGCCTCTGCAGAGTTCTGCAACATCCTCTCCAG
GGTTCTGGCTCGGTCTCGGAAGCGGCCCGCTAAGATCTATGTGTACATTAACGAGCTCTGCACTGTTCTT
AAAGCTCACTCCATCAAGAAGAAGTTGAACTTAGCTCCTGCAGCCTCAACGACCAGTGAGGCGTCGGGCC
CTAACCCTCCCACAGAGCCCCCCTCTGACCTTACAAACACTGAAAACACTGCCTCTGAGGCCTCAAGGAC
TCGCGGTTCCCGGAGGCAGATCCAGCGCCTGGAGCAGCTGCTGGCACTGTACGTAGCCGAGATTCGGCGG
CTGCAGGAGAAGGAGTTGGACCTGTCAGAGCTGGATGACCCAGACTCCTCGTATTTGCAGGAGGCCCGCT
TGAAGAGGAAGTTGATCCGCCTCTTCGGGCGGTTGTGTGAGTTGAAGGACTGCTCTTCTCTGACGGGGCG
GGTCATAGAGCAGCGAATTCCGTACCGAGGCACCCGGTACCCAGAGGTCAACAGGCGCATTGAACGGCTC
ATTAACAAGCCGGGGCTGGACACCTTCCCCGATTATGGAGATGTGCTGAGAGCCGTGGAGAAGGCGGCGA
CCCGGCACAGCCTGGGCCTTCCCAGACAGCAGCTTCAGCTCCTGGCTCAGGATGCCTTCCGGGACGTGGG
CGTCAGGTTACAGGAGCGGCGCCACCTGGATCTCATCTACAACTTTGGCTGTCACCTCACAGATGACTAT
AGGCCAGGCGTTGACCCCGCACTGTCTGATCCCACATTGGCTCGCCGCCTTCGGGAAAATCGAACCTTGG
CCATGAACCGGCTGGATGAGGTCATCTCCAAGTATGCAATGATGCAAGACAAGACTGAGGAGGGCGAGAG
ACAGAAGAGACGAGCCCGGCTCTTAGGCACCGCCCCCCAACCTTCAGACCCCCCCAAAGCCTCCTCGGAA
TCTGGTGAGGGTCCTAGCGGAATGGCATCCCAGGAGTGCCCTACTACCTCCAAAGCTGAGACTGATGATG
ACGATGATGACGATGATGATGACGACGACGAAGATAACGAGGAAAGTGAGGAGGAGGAGGAGGAGGAAGA
GGAGGAGAAAGAGGCTACTGAAGATGAAGATGAGGATCTAGAACAGTTGCAGGAAGATCAGGGGGGTGAT
GAAGAAGAGGAAGGAGGAGATAATGAAGGAAATGAGAGTCCCACATCGCCTTCAGACTTTTTCCATAGAA
GGAATTCAGAGCCTGCAGAAGGGCTCAGGACCCCCGAGGGGCAGCAAAAGAGAGGACTGACAGAGACCCC
AGCATCCCCGCCAGGGGCATCCCTGGACCCTCCCAGCACTGACGCTGAGAGCAGTGGAGAGCAGCTCCTC
GAGCCGCTCCTGGGAGACGAGAGTCCTGTGTCCCAGCTCGCTGAGCTAGAGATGGAAGCTTTGCCTGAGG
AAAGGGACATTTCCTCCTCCAGGAAAAAGTCGGAAGATTCCCTCCCCACCATCTTGGAAAATGGGGCAGC
TGTGGTTACCTCTACATCTGTCAATGGGCGTGTCTCTTCTCACACTTGGAGAGATGCCAGTCCCCCCAGC
AAGAGATTTCGGAAGGAAAAGAAGCAACTGGGCTCTGGACTGTTAGGAAACAGCTATATAAAAGAACCGA
TGGCACAGCAGGACAGTGGGCAGAACACAAGTGTCCAGCCTATGCCATCCCCCCCCTTGGCCTCTGTGGC
TTCTGTCGCTGATTCCTCCACAAGGGTGGACTCTCCCAGCCATGAACTGGTGACCAGCTCTCTGTGCAGC
CCTTCTCCATCCCTGCTTCTCCAGACACCCCAGGCTCAGTCTCTCCGGCAGTGTATTTATAAGACCAGTG
TGGCCACACAGTGCGACCCGGAGGAGATCATCGTGCTTTCAGACTCTGATTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001199733
Insert Size 2223 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001199733.1, NP_001186662.1
RefSeq Size 2698 bp
RefSeq ORF 2223 bp
Locus ID 13163
UniProt ID O35613
Cytogenetics 17 17.98 cM
Gene Summary Transcription corepressor known to repress transcriptional potential of several sumoylated transcription factors. Down-regulates basal and activated transcription. Its transcription repressor activity is modulated by recruiting it to subnuclear compartments like the nucleolus or PML/POD/ND10 nuclear bodies through interactions with MCSR1 and PML, respectively. Seems to regulate transcription in PML/POD/ND10 nuclear bodies together with PML and may influence TNFRSF6-dependent apoptosis thereby. Inhibits transcriptional activation of PAX3 and ETS1 through direct protein-protein interactions. Modulates PAX5 activity; the function seems to involve CREBBP. Acts as an adapter protein in a MDM2-DAXX-USP7 complex by regulating the RING-finger E3 ligase MDM2 ubiquitination activity. Under non-stress condition, in association with the deubiquitinating USP7, prevents MDM2 self-ubiquitination and enhances the intrinsic E3 ligase activity of MDM2 towards TP53, thereby promoting TP53 ubiquitination and subsequent proteasomal degradation. Upon DNA damage, its association with MDM2 and USP7 is disrupted, resulting in increased MDM2 autoubiquitination and consequently, MDM2 degradation, which leads to TP53 stabilization. Acts as histone chaperone that facilitates deposition of histone H3.3. Acts as targeting component of the chromatin remodeling complex ATRX:DAXX which has ATP-dependent DNA translocase activity and catalyzes the replication-independent deposition of histone H3.3 in pericentric DNA repeats outside S-phase and telomeres, and the in vitro remodeling of H3.3-containing nucleosomes. Does not affect the ATPase activity of ATRX but alleviates its transcription repression activity. Upon neuronal activation associates with regulatory elements of selected immediate early genes where it promotes deposition of histone H3.3 which may be linked to transcriptional induction of these genes. Required for the recruitment of histone H3.3:H4 dimers to PML-nuclear bodies (PML-NBs); the process is independent of ATRX and facilitated by ASF1A; PML-NBs are suggested to function as regulatory sites for the incorporation of newly synthesized histone H3.3 into chromatin. Proposed to mediate activation of the JNK pathway and apoptosis via MAP3K5 in response to signaling from TNFRSF6 and TGFBR2. Interaction with HSPB1/HSP27 may prevent interaction with TNFRSF6 and MAP3K5 and block DAXX-mediated apoptosis. In contrast, in lymphoid cells JNC activation and TNFRSF6-mediated apoptosis may not involve DAXX. Plays a role as a positive regulator of the heat shock transcription factor HSF1 activity during the stress protein response (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longer transcript. Both variants 1 and 2 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.