Amigo1 (NM_146137) Mouse Untagged Clone

CAT#: MC227996

Amigo1 (untagged) - Mouse adhesion molecule with Ig like domain 1 (Amigo1), transcript variant 1


  "NM_146137" in other vectors (2)

Reconstitution Protocol

USD 732.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
AMIGO1 Antibody - C-terminal region
    • 100 ul

USD 539.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Amigo1"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Amigo1
Synonyms ali2; Amigo
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC227996 representing NM_146137
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCAACCCCAGCGTGACCTGCGAGGCCTCTGGCTCCTGCTGCTCTCCGTGTTCCTGCTTCTCTTTGAGG
TAGCCAGGGCCGGCCGATCTGTGGTTAGTTGTCCCGCCAACTGCCTGTGCGCCAGCAACATCCTCAGCTG
CTCCAAGCAGCAGCTGCCCAATGTGCCCCAATCTTTGCCCAGCTACACAGCACTGCTGGACCTCAGCCAC
AACAACTTGAGCAGGCTGCGGGCCGAGTGGACCCCCACCCGGCTGACCAACCTGCACTCCCTGCTGCTGA
GCCACAACCACCTGAACTTCATCTCCTCCGAGGCCTTCGTCCCCGTACCCAACCTTAGGTACTTGGACCT
CTCCTCCAACCATCTTCACACGCTGGATGAGTTCCTGTTCAGCGACCTGCAGGCGCTGGAAGTGCTGTTG
CTCTACAATAACCACATTGTGGTGGTGGACCGGAATGCCTTTGAGGACATGGCCCAGCTGCAGAAACTCT
ACTTAAGCCAGAATCAGATCTCTCGCTTTCCTGTGGAACTGATCAAGGATGGGAACAAATTACCCAAACT
GATGCTCTTGGATCTGTCCTCCAACAAGCTGAAGAAGTTGCCCCTGACTGACCTGCAGAAATTGCCAGCC
TGGGTCAAGAATGGGCTATACCTGCATAACAACCCCTTGGAGTGCGACTGCAAGCTCTACCAGCTCTTTT
CGCACTGGCAGTACCGGCAGCTGAGCTCTGTGATGGACTTCCAGGAGGACCTGTACTGCATGCACTCCAA
GAAGCTGCACAACATCTTCAGCCTGGATTTCTTCAATTGCAGCGAGTACAAGGAAAGTGCCTGGGAGGCT
CACCTGGGAGACACCTTGACCATCAGGTGTGACACCAAACAGCAAGGCATGACCAAAGTGTGGGTGTCCC
CAAGCAATGAACAGGTGCTAAGTCAGGGGTCCAATGGCTCGGTGAGCGTGAGGAATGGCGACCTTTTTTT
TAAAAAGGTGCAGGTCGAGGATGGGGGTGTGTATACCTGTTACGCCATGGGGGAGACTTTCAACGAGACA
CTGTCTGTGGAGTTGAAAGTGTATAACTTCACCTTGCACGGACACCATGACACCCTCAACACAGCCTACA
CTACCCTGGTGGGCTGTATCCTCAGTGTGGTTCTGGTCCTCATATACTTGTACCTCACCCCTTGCCGCTG
CTGGTGTCGGGGTGTGGAGAAACCTTCCAGCCACCAAGGAGATAGCCTCAGCTCTTCTATGCTCAGTACC
ACACCCAACCACGACCCTATGGCTGGTGGGGACAAAGATGATGGTTTTGACCGGCGGGTGGCCTTCCTGG
AACCTGCTGGACCCGGGCAGGGTCAAAATGGCAAACTCAAGCCAGGCAACACTCTGCCGGTGCCCGAAGC
TACAGGCAAGGGCCAACGGAGGATGTCCGATCCAGAGTCGGTCAGCTCGGTCTTTTCTGATACACCCATT
GTGGTGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_146137
Insert Size 1479 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_146137.3, NP_666249.2
RefSeq Size 5586 bp
RefSeq ORF 1479 bp
Locus ID 229715
UniProt ID Q80ZD8
Cytogenetics 3 F2.3
Gene Summary Promotes growth and fasciculation of neurites from cultured hippocampal neurons. May be involved in fasciculation as well as myelination of developing neural axons. May have a role in regeneration as well as neural plasticity in the adult nervous system. May mediate homophilic as well as heterophilic cell-cell interaction and contribute to signal transduction through its intracellular domain (By similarity). Assembled with KCNB1 modulates the gating characteristics of the delayed rectifier voltage-dependent potassium channel KCNB1 (PubMed:22056818).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longer isoform (a). Variants 1 and 2 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.