Cacnb1 (NM_001282978) Mouse Untagged Clone

CAT#: MC227864

Cacnb1 (untagged) - Mouse calcium channel, voltage-dependent, beta 1 subunit (Cacnb1), transcript variant 6


  "NM_001282978" in other vectors (1)

Reconstitution Protocol

USD 503.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Cacnb1"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Cacnb1
Synonyms CAB1; Cchb1; Cchlb1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC227864 representing NM_001282978
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGTCCAGAAGAGCGGCATGTCCCGGGGCCCTTACCCACCTTCCCAAGAGATCCCTATGGAGGTCTTCG
ACCCCAGCCCACAGGGCAAGTACAGCAAGAGGAAAGGGCGGTTCAAAAGGTCAGACGGGAGTACGTCCTC
GGATACAACATCCAACAGCTTCGTCCGCCAGGGCTCAGCAGAGTCCTACACGAGCCGACCATCAGACTCT
GATGTGTCTCTGGAGGAGGACCGGGAAGCCTTAAGGAAGGAGGCAGAGCGCCAGGCCTTAGCCCAGCTCG
AGAAAGCCAAGACCAAACCAGTGGCTTTTGCTGTTCGGACAAATGTTGGCTACAATCCGTCTCCAGGGGA
TGAGGTGCCTGTACAGGGAGTGGCCATCACCTTTGAGCCCAAGGACTTCCTACACATCAAGGAGAAGTAC
AATAATGACTGGTGGATTGGGCGGCTGGTGAAGGAAGGCTGCGAGGTTGGCTTCATCCCCAGCCCGGTCA
AACTGGACAGCCTTCGTCTGCTGCAGGAACAGACCCTGCGCCAGAACCGCCTCAGCTCCAGCAAGTCAGG
TGACAACTCCAGTTCCAGTCTGGGAGATGTGGTGACTGGCACCCGCCGCCCCACACCCCCTGCCAGTGAG
CACGTGCCCCCCTATGACGTGGTGCCTTCCATGAGGCCCATCATCCTGGTGGGACCGTCGCTCAAGGGCT
ATGAGGTGACAGACATGATGCAGAAAGCGTTGTTTGACTTCCTCAAGCATCGGTTTGATGGCAGGATTTC
CATCACCCGGGTAACAGCTGACATTTCCCTGGCCAAACGCTCCGTCCTCAACAACCCCAGCAAACACATC
ATCATTGAGCGCTCCAACACGCGTTCCAGCCTGGCTGAGGTACAGAGTGAAATTGAGAGGATCTTCGAGC
TGGCCCGGACCTTGCAGCTGGTCGCCTTGGACGCTGACACCATCAACCACCCAGCCCAGCTCTCTAAAAC
GTCGCTGGCCCCCATCATTGTTTACATCAAGATCACATCTCCCAAGGTACTGCAGAGGCTCATCAAATCC
CGAGGGAAGTCTCAATCCAAACACCTCAATGTCCAAATAGCAGCCTCGGAGAAGCTGGCACAGTGTCCCC
CCGAAATGTTTGACATAATCCTGGACGAGAACCAATTGGAAGATGCCTGCGAGCACCTGGCTGAGTACTT
GGAAGCCTACTGGAAGGCCACACATCCGCCTAGCAGCACGCCACCCAATCCGCTGCTGAACCGCACCATG
GCTACCGCAGCTCTGGCTGCCAGCCCTGCCCCCGTCTCCAACCTCCAGGTACAGGTGCTCACCTCGCTCA
GGAGAAATCTCAGCTTCTGGGGCGGGCTGGAGGCCTCACCGCGGGGAGGCGACGCGGTGGCCCAGCCTCA
GGAGCACGCCATGTAG


AGCGGACCGACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCC
TGGATTACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-RsrII     
ACCN NM_001282978
Insert Size 1416 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001282978.1, NP_001269907.1
RefSeq Size 1714 bp
RefSeq ORF 1416 bp
Locus ID 12295
Cytogenetics 11 61.5 cM
Gene Summary Regulatory subunit of L-type calcium channels. Regulates the activity of L-type calcium channels that contain CACNA1A as pore-forming subunit (By similarity). Regulates the activity of L-type calcium channels that contain CACNA1C as pore-forming subunit and increases the presence of the channel complex at the cell membrane. Required for functional expression L-type calcium channels that contain CACNA1D as pore-forming subunit. Regulates the activity of L-type calcium channels that contain CACNA1B as pore-forming subunit (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (6) lacks an alternate coding exon, uses an alternate splice junction at the 5' end of an exon, and differs in the 3' UTR and coding sequence compared to variant 5. The resulting isoform (F) has a shorter and distinct C-terminus and lacks an alternate internal segment compared to isoform E. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.