Gfra1 (NM_001285457) Mouse Untagged Clone

CAT#: MC227828

Gfra1 (untagged) - Mouse glial cell line derived neurotrophic factor family receptor alpha 1 (Gfra1), transcript variant 3


  "NM_001285457" in other vectors (1)

Reconstitution Protocol

USD 503.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Gfra1"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Gfra1
Synonyms AU042498; GDNFR; GFRalpha-1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC227828 representing NM_001285457
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTTCCTAGCCACTCTGTACTTCGTGCTGCCACTCCTGGATTTGCTGATGTCGGCCGAGGTGAGTGGTG
GGGACCGCCTGGACTGTGTGAAAGCCAGTGATCAGTGCCTGAAGGAACAGAGCTGCAGCACCAAGTACCG
CACACTGAGGCAGTGCGTGGCGGGCAAGGAAACCAACTTCAGCCTGACATCCGGCCTCGAGGCCAAGGAT
GAGTGCCGCAGCGCTATGGAGGCCTTGAAGCAGAAGTCTCTCTACAACTGCCGCTGCAAGCGGGGCATGA
AGAAAGAGAAGAATTGTCTGCGTATCTACTGGAGCATGTACCAGAGCCTGCAGGGAAATGACCTACTGGA
AGATTCCCCATATGAGCCGGTTAACAGCAGGCTGTCAGATATATTCCGGGCAGTCCCGTTCATATCAGTG
GAACACATTTCCAAAGGGAACAACTGCCTCGATGCAGCCAAGGCCTGCAACCTGGATGACACCTGCAAGA
AGTACAGGTCCGCCTACATCACCCCCTGTACCACCAGCATGTCCAATGAAGTCTGCAACCGCCGCAAGTG
CCACAAAGCCCTCAGGCAGTTCTTCGACAAAGTTCCAGCCAAGCACAGCTACGGGATGCTCTTCTGCTCC
TGCCGGGACGTCGCCTGCACCGAGAGGCGGCGACAGACTATCGTCCCTGTGTGCTCCTATGAAGAACGAG
AGAGGCCCAACTGCCTGAATCTGCAAGACTCCTGCAAGACAAATTACATCTGCAGATCTCGCCTTGCAGA
TTTTTTTACCAACTGCCAGCCAGAGTCAAGGTCTGTCAGCAACTGTCTTAAGGAGAACTACGCAGACTGC
CTCCTGGCCTACTCGGGACTGATTGGCACAGTCATGACTCCTAACTACATAGACTCCAGCAGCCTCAGTG
TGGCGCCGTGGTGCGATTGCAGCAACAGTGGCAATGACCTGGAAGATTGCCTGAAGTTTCTGAATTTTTT
TAAGGACAATACGTGTCTCAAAAATGCAATTCAAGCCTTTGGCAATGGCTCGGATGTGACCATGTGGCAG
CCAGCCCCCCCAGTCCAGACCACCACTGCCACGACTACCACTGCCTTCCGGATCAAGAACAAGCCTCTAG
GGCCAGCAGGCTCTGAGAATGAGATTCCCACACACGTTTTACCACCGTGTGCTAATTTGCAGGCACAGAA
GCTGAAATCCAATGTATCGGGCAGTACACATCTCTGTCTTTCTGATAATGATTACGGAAAGGATGGTCTC
GCTGGTGCCTCCAGCCACATAACCACAAAATCAATGGCTGCTCCTCCCAGCTGCGGTCTGAGCTCACTGC
CGGTGATGGTGTTCACCGCTCTGGCTGCCCTGTTGTCTGTATCATTGGCAGAAACATCGTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001285457
Insert Size 1392 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001285457.1, NP_001272386.1
RefSeq Size 4425 bp
RefSeq ORF 1392 bp
Locus ID 14585
UniProt ID P97785
Cytogenetics 19 54.18 cM
Gene Summary This gene encodes a transmembrane protein that functions as the receptor for glial cell line derived neurotrophic factor (GDNF). The encoded protein undergoes proteolytic processing to generate a glycosylphosphatidylinositol-anchored cell surface coreceptor that forms a complex with the Ret tyrosine kinase in GDNF signaling pathway. Mice lacking the encoded protein exhibit deficits in the kidneys, the enteric nervous system, and spinal motor and sensory neurons similar mice deficient in GDNF or Ret. [provided by RefSeq, Jul 2016]
Transcript Variant: This variant (3) has a shorter 5' UTR and lacks an exon in the central coding region but maintains the reading frame, compared to variant 1. The encoded isoform (2) is shorter than isoform 1. This isoform (2) may undergo proteolytic processing similar to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.