Uba3 (NM_001301859) Mouse Untagged Clone

CAT#: MC227473

Uba3 (untagged) - Mouse ubiquitin-like modifier activating enzyme 3 (Uba3), transcript variant 5


  "NM_001301859" in other vectors (1)

Reconstitution Protocol

USD 503.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Uba3"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Uba3
Synonyms A830034N06Rik; AI256736; AI848246; AW546539; Ube1c
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC227473 representing NM_001301859
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCGGATGGCGAGGAGCCGGAGAAGAAAAGAAGGAGAATAGAGGAGCTGCTGGCTGAGAAAATGGCTG
TTGATGGTGGGTGTGGGGACACTGGAGACTGGGAAGGTCGCTGGAACCATGTAAAGAAGTTCCTCGAGCG
GTCTGGACCCTTCACACACCCCGATTTCGAACCAAGCACTGAATCACTCCAGTTCTTGTTAGATACATGT
AAAGTTCTAGTCATTGGAGCTGGTGGCTTAGGATGTGAGCTTCTGAAAAATCTGGCATTATCTGGTTTTA
GACAGATTCATGTTATAGACATGGACACTATAGATGTTTCCAATTTAAATAGACAGTTTTTATTTAGGCC
TAAAGATGTCGGAAGACCCAAGGCTGAAGTTGCTGCAGAATTCCTAAATGACAGAGTTCCTAACTGCAAC
GTGGTACCACATTTCAACAAGATACAAGATTTTAACGACACTTTCTACCGACAATTTCATATCATTGTAT
GTGGCCTGGACTCTATCATAGCGAGAAGATGGATCAATGGAATGCTGATATCTCTTCTAAATTATGAAGA
TGGTGTGTTGGATCCAAGCTCCATTGTACCTTTGATAGATGGGGGGACAGAAGGCTTTAAAGGGAATGCC
CGAGTGATTTTGCCTGGAATGACCGCTTGTATTGAGTGCACTCTGGAACTTTACCCACCACAGGTCAATT
TCCCCATGTGTACCATTGCATCTATGCCCAGGCTCCCAGAACACTGTATCGAGTATGTGAGGATGTTGCA
ATGGCCTAAAGAGCAGCCTTTTGGAGATGGGGTTCCATTAGATGGAGATGACCCTGAACATATTCAGTGG
ATTTTCCAAAAGTCCATAGAGAGAGCATCACAATATAATATTAGAGGCGTTACCTACAGACTCACTCAAG
GGGTGGTAAAACGAATCATTCCTGCAGTAGCTTCTACAAATGCAGTCATTGCAGCTGTGTGTGCCACTGA
GGTTTTCAAGATAGCTACAAGTGCGTACATTCCCCTTAATAACTACCTGGTATTCAATGATGTAGATGGG
CTGTACACTTACACGTTTGAAGCAGAGAGAAAGGAAAACTGTCCAGCATGTAGCCAACTTCCTCAAAACA
TTCAGTTTTCCCCATCAGCTAAACTACAGGAGGTCTTAGACTACCTAACCAACAGTGCTTCTCTGTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001301859
Insert Size 1188 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001301859.1, NP_001288788.1
RefSeq Size 1361 bp
RefSeq ORF 1188 bp
Locus ID 22200
UniProt ID Q8C878
Cytogenetics 6 D3
Gene Summary The protein encoded by this gene is the catalytic subunit of the enzyme that activates NEDD8, a ubiquitin-like molecule that binds to its target proteins through an enzymatic reaction analagous to ubiquitylation. Embryonic mice deficient for this protein die prior to implantation and display apoptosis of the inner cell mass. Trophoblastic cells cannot enter S phase, demonstrating that this gene is required for cell cycle progression during embryogenesis. Two pseudogenes have been found for this gene. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2014]
Transcript Variant: This variant (5) lacks several exons and its 3' terminal exon extends past a splice site that is used in variant 1. This results in a novel 3' coding region and 3' UTR, compared to variant 1. It encodes isoform 5 which is shorter and has a distinct C-terminus, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.