Nfe2 (NM_001302343) Mouse Untagged Clone

CAT#: MC227344

Nfe2 (untagged) - Mouse nuclear factor, erythroid derived 2 (Nfe2), transcript variant 6


  "NM_001302343" in other vectors (1)

Reconstitution Protocol

USD 503.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Rabbit Polyclonal anti-Nfe2 Antibody
    • 100 ul

USD 539.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Nfe2"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Nfe2
Synonyms NF-E2; NF-E2/P45; p45; p45nf-e2; p45NFE2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC227344 representing NM_001302343
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCCCCCGTGTCCTCCTCAGCAGAACAGGAACAGGTTATCACAGCTGCCTGTTGGGGAGCTTGGAGAGA
TGGAACTGACTTGGCAAGAGATCATGTCCATTACTGAGCTGCAGGGTCTAAATGTTCCAAGTGAGACATC
TTTTGAGCCTCAAGCACCCACCCCATACCCTGGGCCACTGCCACCTCCAACATATTGCCCCTGTTCAATT
CATCCAGATGCAGGCTTCTCCCTTCCCCCACCATCTTATGAGCTCCCAGCATCTACTCCCCATGTCCCAG
AACTACCATACTCCTATGGTAATGTAGCCATACCAGTGTCAAAGCCACTTACCCTTTCAGGCCTGCTCAA
TGAGCCCCTCCCAGACCACTTAGCTCTCCTGGACATTGGGCTGCCAGTGGGGCAACCCAAGCCCCAAGAA
GACCCAGAATCTGACTCAGGATTATCCCTCAACTACAGTGATGCAGAATCTCTTGAGCTAGAGGGTATGG
AGGCTGGCAGGCGGAGGAGCGAGTACGCGGACATGTACCCAGTGGAGTATCCTTACTCACTTATGCCCAA
TTCTTTGGCCCATCCCAACTATACTCTTCCACCCACTGAGACACCCTTGGCCTTAGAGTCATCCTCCGGT
CCAGTTCGGGCTAAGCCTGCTGTCCGTGGGGAGGCAGGGAGTCGGGACGAGCGGCGAGCCCTGGCCATGA
AGATTCCTTTCCCTACGGACAAGATAGTTAACTTGCCGGTAGATGACTTTAATGAGTTGTTGGCACAGTA
TCCGCTAACGGAGAGCCAGCTGGCTCTAGTTCGGGACATCCGTCGACGGGGCAAGAACAAGGTGGCAGCC
CAAAACTGTCGCAAGAGAAAACTGGAAACCATTGTGCAGCTGGAGCGAGAGCTGGAGCGGCTGAGCAGTG
AAAGGGAGCGGCTTCTCAGAGCCCGAGGGGAGGCTGACCGCACTCTGGAGGTCATGCGCCAACAGCTGGC
AGAGCTGTACCATGATATTTTCCAGCATCTTCGGGATGAATCTGGCAACAGTTACTCACCAGAGGAATAT
GTACTGCAACAGGCTGCTGATGGTGCCATCTTTCTGGTACCCCGTGGAACCAAAATGGAGGCTACAGATT
GA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001302343
Insert Size 1122 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001302343.1, NP_001289272.1
RefSeq Size 1527 bp
RefSeq ORF 1122 bp
Locus ID 18022
UniProt ID Q07279
Cytogenetics 15 58.62 cM
Gene Summary Component of the NF-E2 complex essential for regulating erythroid and megakaryocytic maturation and differentiation. Binds to the hypersensitive site 2 (HS2) of the beta-globin control region (LCR). This subunit (NFE2) recognizes the TCAT/C sequence of the AP-1-like core palindrome present in a number of erythroid and megakaryocytic gene promoters. Requires MAFK or other small MAF proteins for binding to the NF-E2 motif. May play a role in all aspects of hemoglobin production from globin and heme synthesis to procurement of iron.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (6) differs in the 5' UTR compared to variant 1. Variants 1, 2, 3, 4, 5 and 6 encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.