Nsfl1c (NM_001291074) Mouse Untagged Clone

CAT#: MC227324

Nsfl1c (untagged) - Mouse NSFL1 (p97) cofactor (p47) (Nsfl1c), transcript variant 2


  "NM_001291074" in other vectors (1)

Reconstitution Protocol

USD 503.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Nsfl1c"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Nsfl1c
Synonyms Munc-18c; p47; Stxbp3a
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC227324 representing NM_001291074
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCGGAGGAGCGGCAGGACGCGTTGAGGGAGTTCGTGGCGGTGACTGGCACTGAGGAGGACAGGGCCC
GTTTCTTCCTGGAGTCGGCTGGCTGGGACCTGCAGATTGCACTTGCAAGCTTTTATGAGGATGGAGGGGA
TGAAGACATTGTGACCATTTCACAAGCAACCCCAAGTTCAGTGTCCAGAGGCACAGCTCCTAGTGATAAT
AGAGTGACATCCTTCAGAGACCTCATTCATGACCAAGATGAAGAGGAGGAGGAAGAGGAGGGACAGAGGT
TTTATGCTGGGGGCTCAGAGAGAAGTGGACAGCAGATTGTTGGTCCTCCCCGGAAGAAAAGTCCCAACGA
GCTGGTGGATGATCTGTTTAAGGGTGCCAAAGAGCATGGGGCTGTAGCTGTGGAACGAGTGACCAAGAGC
CCTGGAGAGACCAGTAAACCGAGACCATTTGCAGGAGGGGGCTACCGCCTTGGAGCAGCACCAGAGGAAG
AGTCTGCCTATGTGGCAGGAGAAAGGAGGCGGCATTCAGGCCAGGATGTTCATGTAGTGCTAAAGCTCTG
GAAAACTGGATTCAGCCTAGACAATGGTGACCTTAGAAGCTACCAAGACCCATCCAATGCCCAGTTTCTG
GAGTCTATCCGTAGAGGGGAGGTTCCTGCAGAGCTTCGGAGGTTAGCGCATGGTGGGCAGGTGAACCTGG
ATATGGAGGATCATCGGGATGAGGACTTCGTGAAGCCCAAGGGAGCTTTCAAAGCCTTCACTGGCGAGGG
CCAGAAACTGGGCAGCACGGCCCCCCAGGTATTAAACACCAGCTCTCCAGCCCAACAAGCAGAAAATGAA
GCCAAAGCTAGCTCGTCCATCTTAATCAATGAAGCAGAACCTACCACGAACATCCAAATCCGGCTTGCAG
ATGGCGGGAGGCTGGTGCAGAAATTCAACCACAGCCACAGGATCAGCGACATCCGGCTCTTCATCGTGGA
TGCCCGGCCAGCTATGGCTGCCACCAGTTTTGTCCTTATGACTACCTTCCCTAACAAAGAGCTGGCTGAT
GAGAACCAAACCCTGAAGGAAGCCAACCTTCTCAACGCTGTCATCGTGCAGCGGTTAACATAA


AGCGGACCGACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCC
TGGATTACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-RsrII     
ACCN NM_001291074
Insert Size 1113 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001291074.1, NP_001278003.1
RefSeq Size 1480 bp
RefSeq ORF 1113 bp
Locus ID 386649
UniProt ID Q9CZ44
Cytogenetics 2 G3
Gene Summary Reduces the ATPase activity of VCP. Necessary for the fragmentation of Golgi stacks during mitosis and for VCP-mediated reassembly of Golgi stacks after mitosis. May play a role in VCP-mediated formation of transitional endoplasmic reticulum (tER). Inhibits the activity of CTSL (in vitro). Together with UBXN2B/p37, regulates the centrosomal levels of kinase AURKA/Aurora A during mitotic progression by promoting AURKA removal from centrosomes in prophase. Also, regulates spindle orientation during mitosis.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) lacks an alternate in-frame exon in the central coding region, compared to variant 1, resulting in an isoform (b) that is shorter than isoform a.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.