Camk2d (NM_001293665) Mouse Untagged Clone
CAT#: MC227311
Camk2d (untagged) - Mouse calcium/calmodulin-dependent protein kinase II, delta (Camk2d), transcript variant 6
"NM_001293665" in other vectors (1)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Camk2d |
Synonyms | 2810011D23Rik; 8030469K03Rik; CaMK II; [d]-CaMKII |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC227311 representing NM_001293665
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGAAGGCATGTGAGCAGCCTGAGAATTTGCTTTTAGCTAGCAAGTCCAAAGGAGCAGCTGTGAAGCTGG CAGACTTCGGCTTAGCCATAGAAGTTCAAGGCGACCAGCAGGCATGGTTTGGTTTTGCTGGCACACCTGG GTATCTTTCTCCAGAAGTCCTGCGTAAAGATCCTTATGGAAAACCAGTGGATATGTGGGCATGCGGTGTC ATCCTCTACATCTTGCTGGTGGGATACCCACCCTTCTGGGATGAAGATCAGCATAGACTGTATCAGCAGA TCAAGGCCGGAGCTTACGATTTTCCGTCACCAGAATGGGATACAGTGACACCTGAAGCCAAAGACCTCAT CAACAAAATGCTGACCATCAACCCTGCCAAACGTATCACAGCCTCTGAGGCCCTGAAACACCCATGGATC TGTCAACGCTCTACTGTTGCCTCCATGATGCACAGGCAGGAGACTGTAGACTGCTTGAAGAAATTTAATG CTAGACGGAAACTGAAGGGCGCCATCTTGACAACTATGCTGGCTACGAGAAATTTTTCAGCAGCCAAGAG TTTATTGAAGAAACCAGATGGGGTAAAGGAGTCAACTGAGAGCTCAAACACCACCATTGAGGATGAAGAC GTGAAAGCACGAAAACAGGAGATCATCAAAGTCACTGAGCAACTGATTGAAGCTATCAACAATGGGGACT TTGAGGCTTACACAAAAATCTGTGATCCAGGCCTCACTGCCTTTGAACCTGAAGCATTGGGCAACTTAGT GGAAGGGATGGACTTTCACAGATTCTACTTTGAAAATGCTTTGTCCAAAAGCAATAAACCAATCCACACG ATCATCCTCAACCCACACGTTCACCTGGTAGGGGATGACGCAGCCTGCATCGCATACATTCGGCTCACAC AGTACATGGACGGAAGCGGGATGCCAAAGACCATGCAGTCAGAAGAGACGCGCGTGTGGCACCGCCGTGA TGGGAAGTGGCAGAATGTTCACTTTCACCGTTCGGGGTCCCCCACAGTACCCATCAAGCCACCCTGTATT CCAAATGGGAAAGAGAACTTCTCAGGAGGCACCTCTTTGTGGCAAAACATCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001293665 |
Insert Size | 1104 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001293665.1, NP_001280594.1 |
RefSeq Size | 5595 bp |
RefSeq ORF | 1104 bp |
Locus ID | 108058 |
Cytogenetics | 3 G1 |
Gene Summary | Calcium/calmodulin-dependent protein kinase involved in the regulation of Ca(2+) homeostatis and excitation-contraction coupling (ECC) in heart by targeting ion channels, transporters and accessory proteins involved in Ca(2+) influx into the myocyte, Ca(2+) release from the sarcoplasmic reticulum (SR), SR Ca(2+) uptake and Na(+) and K(+) channel transport. Targets also transcription factors and signaling molecules to regulate heart function. In its activated form, is involved in the pathogenesis of dilated cardiomyopathy and heart failure. Contributes to cardiac decompensation and heart failure by regulating SR Ca(2+) release via direct phosphorylation of RYR2 Ca(2+) channel on 'Ser-2808'. In the nucleus, phosphorylates the MEF2 repressor HDAC4, promoting its nuclear export and binding to 14-3-3 protein, and expression of MEF2 and genes involved in the hypertrophic program. Is essential for left ventricular remodeling responses to myocardial infarction. In pathological myocardial remodeling acts downstream of the beta adrenergic receptor signaling cascade to regulate key proteins involved in ECC. Regulates Ca(2+) influx to myocytes by binding and phosphorylating the L-type Ca(2+) channel subunit beta-2 CACNB2. In addition to Ca(2+) channels, can target and regulate the cardiac sarcolemmal Na(+) channel Nav1.5/SCN5A and the K+ channel Kv4.3/KCND3, which contribute to arrhythmogenesis in heart failure. Phosphorylates phospholamban (PLN/PLB), an endogenous inhibitor of SERCA2A/ATP2A2, contributing to the enhancement of SR Ca(2+) uptake that may be important in frequency-dependent acceleration of relaxation (FDAR) and maintenance of contractile function during acidosis. May participate in the modulation of skeletal muscle function in response to exercise, by regulating SR Ca(2+) transport through phosphorylation of PLN/PLB and triadin, a ryanodine receptor-coupling factor.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (6) has multiple differences compared to variant 1. These differences result in a different 5' UTR, cause translation initiation at an alternate start codon and result in a frameshift compared to variant 1. The encoded isoform (6) has distinct N- and C- termini, and is shorter compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MR229522 | Camk2d (myc-DDK-tagged) - Mouse calcium/calmodulin-dependent protein kinase II, delta (Camk2d), transcript variant 6 |
USD 503.00 |
{0} Product Review(s)
Be the first one to submit a review