Rad51d (NM_001277939) Mouse Untagged Clone

CAT#: MC226931

Rad51d (untagged) - Mouse RAD51 homolog D (Rad51d), transcript variant 3

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Rad51d
• Synonyms: R51H; R51H3; Rad5; Rad51l3; TRAD; Trad-d5
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC226931 representing NM_001277939
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGGCATGCTCAGGGCAGGGCTGTGCCCGGGCCTCACCGAGGAGACCGTCCAGCTTCTCAGAGGCCGAA
  AGATAAAAACAGTGGCAGACCTGGCAGCTGCTGACTTGGAGGAAGTAGCCCAGAAGTGTGGCTTGTCCTA
  CAAGGCCCTCGTTGCCCTGAGGAGGGTGTTGCTGGCGCAGTTCTCGGCTTTCCCCTTAAATGGCGCAGAT
  CTCTATGAGGAACTGAAGACTTCCACGGCCATCCTGTCCACCGGCATCGGAAGCCTGGACAAACTACTTG
  ATGCTGGCCTCTATACTGGGGAGGTGACTGAAATTGTGGGTGGCCCAGGTAGCGGCAAAACCCAGGTGTG
  TCTCTGTGTGGCTGCAAATGTGGCCCATAGCCTGCAGCAGAATGTACTGTATGTGGATTCCAATGGAGGA
  ATGACGGCGTCCCGCCTCCTCCAGCTACTACAGGCTAGAACCCAAGATGAGGAGAAACAGGCAAGTGCTC
  TCCAGAGGATACAGGTGGTGCGTTCATTTGACATCTTCCGGATGCTAGATATGCTACAGGACCTTCGCGG
  CACCATAGCCCAGCAGGAAGCAACTTCTTCAGGCGCCGTGAAGGTTGTGATTGTGGACTCGGTCACTGCA
  GTGGTCGCCCCACTTCTGGGAGGTCAGCAGAGGGAAGGCCTGGCCTTGATGATGCAGCTGGCCCGAGAGC
  TCAAGATCCTGGCCCGGGACCTGGGTGTGGCAGTGGTGGTGACCAACCACTTGACTCGAGATTGGGATGG
  TAGAAGATTCAAACCTGCCCTTGGACGCTCCTGGAGCTTTGTGCCCAGTACCCGGATTCTCCTGGATGTC
  ACTGAGGGGGCTGGGACACTCGGTAGCAGCCAACGCACAGTATGTCTGACCAAGTCTCCCCGCCAGAGAT
  GGACAGTGTGGTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001277939
• Insert Size: 924 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001277939.1, NP_001264868.1
• RefSeq Size: 1722 bp
• RefSeq ORF: 924 bp
• Locus ID: 19364
• Cytogenetics: 11 50.3 cM
• Gene Summary: This gene belongs to the Rad51 gene family whose products play a major role in homologous recombination and DNA repair. The encoded protein interacts with other proteins of this family, including Rad51b, Rad51c and Xrcc2, and plays an essential role in both DNA repair and telomere maintenance. In humans, germline mutations in this gene may be associated with predisposition to ovarian cancer. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2013]
  Transcript Variant: This variant (3, also known as Rad51d-delta10) contains an alternate 3' terminal exon, compared to variant 1. It encodes isoform 3 which is shorter and has a distinct C-terminus, compared to isoform 1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.