Otx2 (NM_001286481) Mouse Untagged Clone

CAT#: MC226881

Otx2 (untagged) - Mouse orthodenticle homolog 2 (Otx2), transcript variant 1

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Otx2
• Synonyms: E130306E05Rik
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC226881 representing NM_001286481
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGATGTCTTATCTAAAGCAACCGCCTTACGCAGTCAATGGGCTGAGTCTGACCACTTCGGGTATGGACT
  TGCTGCATCCCTCCGTGGGCTACCCCGGGCCCTGGGCTTCTTGTCCTGCAGCCACCCCCCGGAAACAGCG
  AAGGGAGAGGACGACATTTACTAGGGCACAGCTCGACGTTCTGGAAGCTCTGTTTGCCAAGACCCGGTAC
  CCAGACATCTTCATGAGGGAAGAGGTGGCACTGAAAATCAACTTGCCAGAATCCAGGGTGCAGGTATGGT
  TTAAGAATCGAAGAGCTAAGTGCCGCCAACAGCAGCAGCAGCAGCAGAATGGAGGTCAGAACAAAGTGAG
  GCCTGCCAAGAAGAAGAGCTCTCCAGCTCGGGAAGTGAGTTCAGAGAGTGGAACAAGTGGCCAGTTCAGT
  CCCCCCTCTAGTACCTCAGTCCCAACCATTGCCAGCAGCAGTGCTCCAGTGTCTATCTGGAGCCCAGCGT
  CCATCTCCCCACTGTCTGACCCCTTGTCCACTTCCTCCTCCTGCATGCAGAGGTCCTATCCCATGACCTA
  TACTCAGGCTTCAGGTTATAGTCAAGGCTATGCTGGCTCAACTTCCTACTTTGGGGGCATGGACTGTGGA
  TCTTATTTGACCCCTATGCATCACCAGCTTCCTGGACCAGGGGCCACACTCAGTCCCATGGGTACCAATG
  CTGTTACCAGCCATCTCAATCAGTCCCCAGCTTCTCTTTCCACCCAGGGATATGGAGCTTCAAGCTTGGG
  TTTTAACTCAACCACTGATTGCTTGGATTATAAGGACCAAACTGCCTCTTGGAAGCTTAACTTCAATGCT
  GACTGCTTGGATTATAAAGATCAGACGTCCTCATGGAAATTCCAGGTTTTGTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001286481
• Insert Size: 894 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001286481.1, NP_001273410.1
• RefSeq Size: 2341 bp
• RefSeq ORF: 894 bp
• Locus ID: 18424
• Cytogenetics: 14 25.36 cM
• Gene Summary: This gene encodes a protein that belongs to the homeobox family of transcription factors. The encoded protein plays a role in the development and patterning of the head. This protein regulates development of the choroid plexuses in the brain affecting composition of cerebrospinal fluid in the developing brain and is thought to function in the development of sense organs in the embryo. In humans, mutations in this gene are associated with pituitary hormone deficiency. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Nov 2013]
  Transcript Variant: This variant (1) encodes the longest isoform (a). Variants 1, 5 and 6 encode the same isoform (a).