Rprd1b (NM_001291135) Mouse Untagged Clone

CAT#: MC226855

Rprd1b (untagged) - Mouse regulation of nuclear pre-mRNA domain containing 1B (Rprd1b), transcript variant 3

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Rprd1b
• Synonyms: 2610304G08Rik; 2810446G03Rik; Crept
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC226855 representing NM_001291135
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGTCCTCCTTCTCAGAATCGGCGCTGGAAAAGAAGCTCTCAGAGCTGAGCAACTCTCAGCAGAGCGTGC
  AGACCCTCTCCCTGTGGCTCATCCACCACCGCAAGCACGCAGGACCCATCGTCTCCGTGTGGCACCGCGA
  GCTCCGCAAAGCCAAATCAAATAGAAAGCTTACTTTTCTATACTTAGCAAATGATGTCATCCAAAACAGT
  AAAAGGAAAGGACCTGAGTTCACAAGAGAATTTGAGTCTGTGCTTGTGGATGCTTTTTCTCATGTTGCCA
  GAGAGGCAGATGAAGGCTGTAAAAAACCTTTAGAAAGATTGCTGAACATCTGGCAAGAACGAAGTGTGTA
  CGGCGGCGAGTTCATACAGCAGCTGAAGCTGTCTATGGAGGACTCCAAGAGCCCTCCCCCCAAAGCAGCA
  GAAGAGAAGAAGTCTCTAAAACGAACTTTTCAGCAGATACAAGAGGAGGAAGATGATGACTACCCTGGAA
  GCTACTCTCCCCAAGACCCTTCTGCAGGCCCTCTCTTGACTGAGGAGTTAATCAAAGCTTTGCAGGATCT
  GGAAAATGCTGCGTCAGGGGATGCTACTGTCCGACAGAAGATCGCTTCCCTGCCTCAGGAAGTGCAAGAC
  GTGTCGCTGCTAGAGAAAATTACAGACAAAGAGGCAGCTGAACGTCTTTCAAAAACAGTAGATGAAGCAT
  GTCTGTTACTAGCGGAATATAACGGGCGCCTGGCAGCGGAACTGGAAGACCGGCGCCAGCTGGCTCGGAT
  GCTGGTGGAATACACCCAGAACCAGAAAGAGGTTTTGTCAGAAAAAGAGAAAAAACTAGAACGTCTTACT
  CAGCAGCTCCAGCCCTGCTCTGATCCCCAGAATGTATCCTTCTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001291135
• Insert Size: 885 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001291135.1, NP_001278064.1
• RefSeq Size: 4616 bp
• RefSeq ORF: 885 bp
• Locus ID: 70470
• UniProt ID: Q9CSU0
• Cytogenetics: 2 H1
• Gene Summary: Interacts with phosphorylated C-terminal heptapeptide repeat domain (CTD) of the largest RNA polymerase II subunit POLR2A, and participates in dephosphorylation of the CTD. Transcriptional regulator which enhances expression of CCND1. Promotes binding of RNA polymerase II to the CCDN1 promoter and to the termination region before the poly-A site but decreases its binding after the poly-A site. Prevents RNA polymerase II from reading through the 3' end termination site and may allow it to be recruited back to the promoter through promotion of the formation of a chromatin loop. Also enhances the transcription of a number of other cell cycle-related genes including CDK2, CDK4, CDK6 and cyclin-E but not CDKN1A, CDKN1B or cyclin-A. Promotes cell proliferation (By similarity).[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (3) contains an additional exon in the 3' region, and it thus differs in its 3' coding region and 3' UTR, compared to variant 1. The encoded isoform (c) has a distinct C-terminus and is shorter than isoform a.