Dazl (NM_001277863) Mouse Untagged Clone

CAT#: MC226765

Dazl (untagged) - Mouse deleted in azoospermia-like (Dazl), transcript variant 2

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Dazl
• Synonyms: Da; Daz-l; Daz-like; Dazh; Dazl1; Dazla; Tpx; Tpx-; Tpx-2; Tpx2
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC226765 representing NM_001277863
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGTCTGCCACAACTTCTGAGGCTCCAAATTCAGCTGTCTCCAGGGAGGCCAGCACTCAGTCTTCATCAG
  CAACCACAAGTCAAGGATATGTTTTGCCAGAAGGCAAAATCATGCCAAACACCGTTTTTGTTGGAGGAAT
  TGATGTTAGGATGGATGAAACCGAAATCAGGAGTTTCTTTGCCAGATATGGCTCAGTAAAAGAAGTGAAG
  ATAATCACTGATCGAACTGGTGTGTCGAAGGGCTATGGATTTGTCTCATTTTATAATGACGTGGATGTGC
  AGAAGATAGTAGAATCACAGATAAATTTCCATGGTAAAAAGCTGAAACTGGGCCCTGCAATCAGGAAACA
  AAATTTATGTACTTATCATGTGCAGCCACGTCCTTTGATTTTTAATCCTCCTCCTCCACCACAGTTCCAG
  AGTGTTTGGAGTAGTCCAAATGCTGAGACTTACATGCAGCCTCCAACCATGATGAATCCTATCACTCAGT
  ATGTTCAGGCATATCCTCCTTATCCAAGTTCACCAGTTCAGGTCATCACTGGATATCAGCTGCCTGTTTA
  TAACTACCAGGCTTATACAACTGTTAACTACCACTGCAGTGAAGTTGATCCAGGAGCTGATATTTTGCCC
  AATGAATGTTCAGTTCATGATGCTGCTCCAGCTTCTGGAAATGGCCCGCAAAAGAAGTCTGTGGACCGAA
  GCATACAGACAGTGGTCTCTTGTCTGTTTAACCCTGAGAACAGACTGAGAAACTCTCTTGTTACTCAAGA
  TGACTACTTCAAGGATAAAAGAGTACATCACTTCAGAAGAAGTCGGGCAGTGCTTAAATCTGATCATCTC
  TGCTAA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001277863
• Insert Size: 846 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001277863.1, NP_001264792.1
• RefSeq Size: 2913 bp
• RefSeq ORF: 846 bp
• Locus ID: 13164
• UniProt ID: Q64368
• Cytogenetics: 17 25.86 cM
• Gene Summary: This gene encodes a member of the depleted in azoospermia-like (DAZL) protein family. Members of this family contain an RNA recognition motif, interact with poly A binding proteins, and may be involved in the initiation of translation. The encoded protein is expressed in the cytoplasm of pluripotent stem cells, and in both male and female germ cells, where it is essential for gametogenesis. Disruption of this gene is associated with infertility. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2013]
  Transcript Variant: This variant (2, also known as Dazl_delta8) lacks an in-frame exon in the coding region, compared to variant 1. The encoded isoform (2) is shorter, compared to isoform 1. There are no full-length transcripts supporting this variant; it is supported by data in PMID:23298641, with additional support from the partial transcript AW557186.2.