Folr2 (NM_001303239) Mouse Untagged Clone

CAT#: MC226582

Folr2 (untagged) - Mouse folate receptor 2 (fetal) (Folr2), transcript variant 1

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Folr2
• Synonyms: FBP; FBP2; Fol; Folb; Folbp-2; Folbp2; FR-; FR-beta; FR-P3
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC226582 representing NM_001303239
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGCCTGGAAACAGACACCACTCTTGCTTTTGGTCTACATGGTCACAACAGGCAGTGGCCGGGACAGAA
  CAGACCTACTCAACGTTTGCATGGATGCCAAACACCATAAGACAAAGCCGGGCCCCGAGGACAAGCTGCA
  TGACCAGTGTAGTCCATGGAAGAAAAATGCCTGTTGCTCAGTCAACACCAGCCAGGAGCTACACAAGGCT
  GACTCCCGTCTGTACTTCAACTGGGATCACTGTGGCAAGATGGAGCCTGCCTGTAAGAGTCACTTCATCC
  AAGACTCCTGCCTGTATGAGTGCTCCCCCAACCTTGGGCCTTGGATCCAGCAAGTGGACCAGAGTTGGCG
  TAAAGAGCGTTTCCTGGATGTGCCCTTATGCAAAGAGGACTGTCACCAGTGGTGGGAAGCCTGTCGTACC
  TCCTTTACCTGCAAGAGAGACTGGCATAAAGGCTGGGACTGGTCCTCAGGCATTAACAAGTGCCCAAACA
  CAGCACCCTGTCACACGTTTGAGTACTACTTCCCGACACCAGCCAGCCTTTGCGAGGGTCTCTGGAGTCA
  CTCCTACAAGGTCAGCAACTACAGCAGAGGGAGTGGCCGCTGCATCCAGATGTGGTTTGACTCAACCCAG
  GGCAATCCGAATGAGGACGTGGTGAAGTTTTATGCTTCCTTTATGACATCTGGGACTGTGCCCCATGCAG
  CAGTACTTCTTGTGCCCAGCCTGGCCCCAGTGCTGTCATTATGGCTCCCTGGCTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001303239
• Insert Size: 756 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001303239.1, NP_001290168.1
• RefSeq Size: 1218 bp
• RefSeq ORF: 756 bp
• Locus ID: 14276
• UniProt ID: Q05685
• Cytogenetics: 7 E2
• Gene Summary: This gene encodes a receptor protein located on the plasma membrane that mediates folate uptake by cells. Mice lacking the product of this gene show no defects in embryonic development and grow normally into fertile adults. However, such mice were found to be highly susceptible to the teratogenic effects of arsenic. Alternate splicing of this gene results in multiple transcript variants. [provided by RefSeq, Dec 2014]
  Transcript Variant: This variant (1) represents the longest transcript. All variants (1-3) encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.