Tpm3 (NM_001271764) Mouse Untagged Clone

CAT#: MC226561

Tpm3 (untagged) - Mouse tropomyosin 3, gamma (Tpm3), transcript variant Tpm3.5

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Tpm3
• Synonyms: gamma-TM; hTM30nm; hTMnm; Tm5NM; TM30nm; TMnm; Tpm-5; Tpm5; Trop-5
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC226561 representing NM_001271764
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGCCGGGACCACCACCATCGAGGCGGTAAAGCGCAAGATCCAGGTTCTGCAGCAGCAAGCTGATGATG
  CGGAGGAAAGGGCCGAGCGCCTCCAGCGGGAAGTGGAGGGAGAAAGGCGGGCCCGGGAGCAGGCTGAAGC
  TGAGGTGGCCTCCTTGAACCGCAGGATCCAGCTGGTTGAAGAGGAGCTGGACCGTGCGCAGGAGCGCCTT
  GCCACTGCTTTGCAGAAGCTGGAGGAAGCAGAGAAGGCTGCTGATGAGAGTGAGAGAGGTATGAAGGTGA
  TTGAAAATCGGGCTCTAAAAGATGAAGAAAAGATGGAACTCCAGGAAATCCAGCTAAAGGAAGCAAAGCA
  CATTGCAGAAGAGGCCGATAGGAAGTATGAAGAGGTGGCTCGTAAGTTGGTGATTATTGAAGGAGACTTG
  GAACGCACGGAGGAACGTGCTGAGCTGGCAGAGTCCCGTTGCCGAGAGATGGATGAACAGATCAGACTGA
  TGGACCAGAACCTGAAGTGTCTGAGTGCTGCTGAAGAAAAGTACTCTCAAAAAGAAGACAAGTATGAAGA
  AGAAATAAAGATTCTTACTGATAAACTCAAGGAGGCAGAGACCCGTGCTGAGTTTGCTGAAAGATCGGTA
  GCCAAGCTGGAGAAGACCATTGATGACCTGGAAGACGAGCTCTATGCCCAGAAACTGAAGTACAAGGCCA
  TTAGCGACGAGCTGGACCACGCCCTCAATGACATGACCTCTATATAA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001271764
• Insert Size: 747 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001271764.1, NP_001258693.1
• RefSeq Size: 2345 bp
• RefSeq ORF: 747 bp
• Locus ID: 59069
• Cytogenetics: 3 F1
• Gene Summary: Binds to actin filaments in muscle and non-muscle cells. Plays a central role, in association with the troponin complex, in the calcium dependent regulation of vertebrate striated muscle contraction. Smooth muscle contraction is regulated by interaction with caldesmon. In non-muscle cells is implicated in stabilizing cytoskeleton actin filaments.[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (5, also known as variant Tpm3.5) represents the use of an alternate promoter and has multiple differences compared to variant Tpm3.13. These differences result in different 5' and 3' UTRs and cause translation initiation at an alternate start codon compared to variant Tpm3.13. The encoded isoform (Tpm3.5cy, also known as isoform 5) has distinct N- and C- termini and is shorter than isoform Tpm3.13cy. Isoforms Tpm3.1cy, Tpm3.2cy, and Tpm3.5cy are the same length, but contain distinct C-termini.