Clec4a3 (NM_001204241) Mouse Untagged Clone

CAT#: MC226483

Clec4a3 (untagged) - Mouse C-type lectin domain family 4, member a3 (Clec4a3), transcript variant 2

USD 227.00


Availability*
2 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Clec4a3 (NM_001204241) Mouse Untagged Clone
Symbol Clec4a3
Synonyms 3110037K17Rik; Dcir3
Vector pCMV6-Entry
Sequence Data
>MC226483 representing NM_001204241
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTTTTCAGAAAACATTTATGTTAACACGAACTTCAAAAATAAAGTTGACTCCTCAGACATCGACACAG
ACTCTTGGCCAGCTCCCCAAAGGAAGAACACGTCTCAGAAAAGTTGTCACAAATTCTCTAAGGTCCTCTT
TACCTCACTCATAATCTATTTCCTGCTGTTGACAATCTTATTCTCCGGTGCTCTGATCACTTTGTTTACA
AAATATTCTCAGCTTCTTGAAGAAAAAATGATTATAAAAGAACTGAACTATACTGAATTGGAGTGTACAA
AATGGGCTTCACTCTTGGAAGACAAAGTCTGGAGCTGTTGCCCAAAGGATTGGAAGCCGTTTGGTTCCTA
CTGCTACTTCACTTCAACTGACTTGGTGGCATCTTGGAATGAGAGTAAGGAGAACTGCTTCCACATGGGT
GCTCATCTGGTGGTGATCCACAGCCAGGAAGAACAGGATTTCATCACTGGGATCCTGGACACTGGTACTG
CTTATTTTATAGGACTTTCAAATCCAGGTGATCAACAATGGCAATGGATTGATCAGACACCGTACGATGA
TAATACCACATTCTGGCACAAAGGTGAGCCTAGCAGTGACAATGAACAGTGTGTTATAATAAATCATCGT
CAGAGTACTGGATGGGGCTGGAGTGATATCCCTTGCAGTGATAAACAGAACTCAATTTGCCATGTGAAAA
AAATATACTTATGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001204241
ORF Size 714 bp
Insert Size 714
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001204241.1, NP_001191170
RefSeq Size 1192
RefSeq ORF 714
Locus ID 73149
Cytogenetics 6|6 F2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.