Kcnip4 (NM_001199245) Mouse Untagged Clone

CAT#: MC226459

Kcnip4 (untagged) - Mouse Kv channel interacting protein 4 (Kcnip4), transcript variant 6

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Kcnip4
• Synonyms: AV032399; Calp; Calp250; KChIP4; KChIP4a
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC226459 representing NM_001199245
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGCTGACTCTAGAGTGGGAGTCGGAAGGACTGCAAACAGTGGGTATTGTTGTGATTATATGTGCGTCTC
  TGAAGCTGCTTCATTTGCTGGGACTGATTGATTTTTCGGAAGACAGCGTGGAAGATGAGCTGGAGATGGC
  TACTGTCAGGCATCGGCCTGAAGCCCTGGAGCTGCTGGAGGCCCAGAGCAAATTCACCAAGAAAGAGCTT
  CAGATTCTTTACAGAGGATTTAAGAATGAATGCCCCAGTGGTGTTGTTAATGAAGAAACTTTCAAGGAGA
  TTTACTCACAGTTCTTTCCACAGGGAGACTCCACCACATATGCACATTTTCTCTTCAATGCATTCGACAC
  GGACCACAATGGAGCTGTGAGCTTTGAGGATTTCATCAAAGGTCTTTCCATTTTGCTTCGAGGGACAGTA
  CAAGAAAAACTCAACTGGGCATTTAATTTGTATGACATAAACAAAGATGGCTACATCACTAAAGAAGAAA
  TGCTGGACATAATGAAAGCAATCTACGACATGATGGGGAAATGCACATACCCGGTCCTCAAGGAAGATGC
  TCCCCGACAGCATGTGGAGACGTTCTTCCAGAAGATGGACAAAAATAAAGATGGTGTCGTTACCATAGAT
  GAGTTCATTGAAAGTTGCCAAAAAGATGAAAACATAATGCGCTCCATGCAGCTCTTTGAAAATGTGATCT
  AG
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001199245
• Insert Size: 702 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001199245.1, NP_001186174.1
• RefSeq Size: 2256 bp
• RefSeq ORF: 702 bp
• Locus ID: 80334
• Cytogenetics: 5 B3
• Gene Summary: Regulatory subunit of Kv4/D (Shal)-type voltage-gated rapidly inactivating A-type potassium channels, such as KCND2/Kv4.2 and KCND3/Kv4.3 (PubMed:19109250). Modulates channel expression at the cell membrane, gating characteristics, inactivation kinetics and rate of recovery from inactivation in a calcium-dependent and isoform-specific manner.[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (6) has a distinct 5' end, compared to variant (1), which results in an isoform (6) with a shorter and distinct N-terminus, compared to isoform 1.