Trub2 (NM_001290495) Mouse Untagged Clone

CAT#: MC226336

Trub2 (untagged) - Mouse TruB pseudouridine (psi) synthase homolog 2 (E. coli) (Trub2), transcript variant 2

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Trub2
• Synonyms: G430055L02Rik
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC226336 representing NM_001290495
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGTCCAGGCTTCTGGTGTGCTTGGATTACACAGTGCGTGGCCTCCTGGGCAAAGCTACAGACAACTTCT
  GTGAAGATGGACGGCTGATAGAGAAGACAACGTATGACCACGTGACCAGAGAGCGGCTGGACCGGATCCT
  GGCTGTGATCCAAGGCTCCCACCAAAAAGCTCTGGTGATGTACTCCAACCTGGACCTGAAATCCCAGGAG
  GCCTATGAGATGGCTGTGCAAGGTGTGATCAGGCCCATGAACAAGTCCCCCATGCTCATCTCTGGCATCC
  GCTGCCTGCACTTTGCACCTCCCGAGTTTCTTTTGGAGGTGCAGTGTATGCACGAGACGCAGCAGCAGCT
  GAGGAAGCTGGTGCATGAAATCGGCCTGGAGCTGAAGACCAGCGCTGTCTGCACGCAAGTGCGGCGGACT
  CGGGATGGCTTCTTCGGCCTGGATGATGCCCTCCTGAGAACCCAGTGGGACCTACACAACATCCAGGATG
  CTATCCAGGCGGCAGCTCCCCGGGTGGCAGCGGAACTGCAAAAGAACTTGAGCCTAAAGCTGGGCCACCA
  TCAGCTCCCCAGCACTGGGCAACCTTGGGGTCTCAAGGACCCAAGCTCCACTTTGGAGTTGGAAAGCTGT
  TCAGGGCAGTAA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001290495
• Insert Size: 642 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001290495.1, NP_001277424.1
• RefSeq Size: 3941 bp
• RefSeq ORF: 642 bp
• Locus ID: 227682
• Cytogenetics: 2 B
• Gene Summary: Minor enzyme contributing to the isomerization of uridine to pseudouridine (pseudouridylation) of specific mitochondrial mRNAs (mt-mRNAs) such as COXI and COXIII mt-mRNAs. As a component of a functional protein-RNA module, consisting of RCC1L, NGRN, RPUSD3, RPUSD4, TRUB2, FASTKD2 and 16S mitochondrial ribosomal RNA (16S mt-rRNA), controls 16S mt-rRNA abundance and is required for intra-mitochondrial translation.[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (2) lacks an alternate internal exon, resulting in translation initiation at an alternate start codon, compared to variant 1. The encoded isoform (b) has a distinct N-terminus and is shorter than isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.