Hgf (NM_001289460) Mouse Untagged Clone
CAT#: MC226324
Hgf (untagged) - Mouse hepatocyte growth factor (Hgf), transcript variant 4
"NM_001289460" in other vectors (1)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Hgf |
Synonyms | C230052L06Rik; HGF/S; HGF/SF; NK; NK1; NK2; SF; SF/HG; SF/HGF |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC226324 representing NM_001289460
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGATGTGGGGGACCAAACTTCTGCCGGTCCTGTTGCTGCAGCATGTCCTCCTGCACCTCCTCCTGCTTC ATGTCGCCATCCCCTATGCAGAAGGACAGAAGAAAAGAAGAAATACACTTCATGAATTTAAAAAGTCAGC AAAAACTACTCTTACCAAGGAAGACCCATTACTGAAGATTAAAACCAAAAAAGTGAACTCTGCAGATGAG TGTGCCAACAGGTGTATCAGGAACAGGGGCTTTACGTTCACTTGCAAGGCCTTCGTTTTTGATAAGTCAA GAAAACGATGCTACTGGTATCCTTTCAATAGTATGTCAAGTGGAGTGAAAAAAGGGTTTGGCCATGAATT TGACCTCTATGAAAACAAAGACTATATTAGAAACTGCATCATTGGTAAAGGAGGCAGCTATAAAGGGACG GTATCCATCACTAAGAGTGGCATCAAATGCCAGCCTTGGAATTCCATGATCCCCCATGAACACAGCTTTT TGCCTTCGAGCTATCGCGGTAAAGACCTACAGGAAAACTACTGTCGAAATCCTCGAGGGGAAGAAGGGGG ACCCTGGTGTTTCACAAGCAATCCAGAGGTACGCTACGAAGTCTGTGACATTCCTCAGTGTTCAGAAGGT AAATGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001289460 |
Insert Size | 636 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001289460.2, NP_001276389.1 |
RefSeq Size | 2143 bp |
RefSeq ORF | 636 bp |
Locus ID | 15234 |
UniProt ID | Q08048 |
Cytogenetics | 5 7.07 cM |
Gene Summary | This gene encodes a protein that binds to the hepatocyte growth factor receptor to regulate cell growth, cell motility and morphogenesis in numerous cell and tissue types. The encoded preproprotein is proteolytically processed to generate multiple protein products, including the hepatocyte growth factor alpha and beta chains, which heterodimerize to form the mature active protein. Although this protein is a member of the peptidase S1 family of serine proteases, it lacks peptidase activity. Homozygous knockout mice for this gene exhibit embryonic lethality due to impaired development of the placenta and liver. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2015] Transcript Variant: This variant (4) lacks multiple 3' coding exons and its 3' terminal exon extends past a splice site used in variant 1, resulting in a different 3' coding region and 3' UTR. The encoded isoform (2) lacks most of the alpha chain and the entire beta chain, has a distinct C-terminus and is shorter compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MR228535 | Hgf (myc-DDK-tagged) - Mouse hepatocyte growth factor (Hgf), transcript variant 4 |
USD 330.00 |
{0} Product Review(s)
Be the first one to submit a review