Hmgb3 (NM_001293623) Mouse Untagged Clone

CAT#: MC226253

Hmgb3 (untagged) - Mouse high mobility group box 3 (Hmgb3), transcript variant 1

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Hmgb3
• Synonyms: Hmg2a; Hmg4
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC226253 representing NM_001293623
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGCTAAAGGTGACCCCAAGAAACCAAAGGGCAAGATGTCTGCTTATGCCTTCTTTGTGCAGACATGCA
  GGGAAGAACATAAGAAGAAAAACCCAGAGGTTCCCGTCAATTTTGCTGAGTTCTCCAAGAAGTGCTCGGA
  GAGGTGGAAGACCATGTCTAGCAAAGAGAAATCAAAGTTTGATGAAATGGCAAAGGCAGATAAAGTCCGA
  TATGATCGGGAGATGAAAGATTATGGACCAGCTAAAGGAGGCAAGAAGAAGAAGGACCCAAATGCCCCCA
  AAAGACCTCCGTCTGGATTTTTCTTATTCTGCTCTGAATTCCGCCCCAAGATCAAATCCACAAACCCTGG
  CATCTCCATTGGAGATGTGGCAAAAAAGCTGGGTGAGATGTGGAATAACTTAAGTGACAATGAAAAGCAG
  CCTTATGTCACCAAGGCAGCAAAGCTGAAGGAGAAGTATGAGAAGGATGTTGCTGACTATAAGTCTAAAG
  GGAAGTTTGATGGTGCCAAGGGTCCTGCTAAAGTTGCCCGGAAAAAGGTGGAAGAAGAGGAAGAGGAGGA
  GGAAGAGGAAGAAGAGGAGGAGGAAGAGGAGGAAGATGAATAA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001293623
• Insert Size: 603 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001293623.1, NP_001280552.1
• RefSeq Size: 1798 bp
• RefSeq ORF: 603 bp
• Locus ID: 15354
• UniProt ID: O54879
• Cytogenetics: X A7.3
• Gene Summary: Multifunctional protein with various roles in different cellular compartments. May act in a redox sensitive manner. Associates with chromatin and binds DNA with a preference to non-canonical DNA structures such as single-stranded DNA. Can bent DNA and enhance DNA flexibility by looping thus providing a mechanism to promote activities on various gene promoters (By similarity). Proposed to be involved in the innate immune response to nucleic acids by acting as a cytoplasmic promiscuous immunogenic DNA/RNA sensor (PubMed:19890330). Negatively regulates B-cell and myeloid cell differentiation. In hematopoietic stem cells may regulate the balance between self-renewal and differentiation. Involved in negative regulation of canonical Wnt signaling (PubMed:12714519, PubMed:15358624, PubMed:16945912).[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (1) represents the longest transcript. Variants 1, 2, 3, and 4 encode the same protein.