Zfp41 (NM_001044718) Mouse Untagged Clone

CAT#: MC226240

Zfp41 (untagged) - Mouse zinc finger protein 41 (Zfp41), transcript variant 2


  "NM_001044718" in other vectors (1)

Reconstitution Protocol

USD 330.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Zfp41"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Zfp41
Synonyms CTfin92; Zfp-41
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226240 representing NM_001044718
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAAAAGCCTGCAACTAGGAAAAAGAAGAGTCAGGCCCCAAAGGAGGAGGCAGGTGCGCAAAAGGCCA
CTGTCAAGGGAGAGAAAACATCAAAGGGGAAAAAGGCAACCAAGAAGCCAAGAAAGCCCCGCAGACCCCG
AAAAGAACCTGTCCTGAGCCCCGAGGACGAAGCACATATCTTTGATGCCTTCGATGCCTCGTTTAAAGAT
GACTTTGAGGGTGTCCCCGTGTTTGTCCCTTTTCAGAGGAAGAAGCCCTATGAGTGTGGTGAATGTGGAC
GGATCTTTAAACACAAGACAGATCACATTCGCCACCAGAGAGTTCACACTGGAGAGAAGCCCTTTAAGTG
TGACCAGTGTGGGAAGACCTTCAGGCACAGCTCAGATGTCACCAAACATCAAAGAATTCACACCGGTGAG
AAGCCCTTTAAATGTGGGGAGTGTGGAAAAGCCTTCAACTGTGGTTCTAACCTTCTAAAACACCAGAAAA
CGCACACTGGAGAGAAACCTTATGGCTGTGAGGAGTGTGGAAAATCCTTCGCCTACAGCTCCTGCCTCAT
CCGGCATCGGAAGCGTCATCCGAGGAAGAAGCACTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001044718
Insert Size 597 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001044718.2, NP_001038183.1
RefSeq Size 3553 bp
RefSeq ORF 597 bp
Locus ID 22701
UniProt ID Q02526
Cytogenetics 15 D3
Gene Summary A putative DNA-binding regulatory protein associated with meiosis in spermatogenesis.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) differs in the 5' UTR, compared to variant 1. Both variants 1 and 2 encode the same protein. CCDS Note: This CCDS ID represents the protein described in PMID: 1397691. This protein is encoded by two alternate splice variants supported by BC053927.1 and AK030420.1. It should be noted this transcript is predicted to undergo nonsense-mediated mRNA decay (NMD). However, the protein is represented because it was detected endogenously in PMID: 1397691. It is likely that the majority of transcripts representing this variant will undergo NMD, while some low level of NMD escape may allow for the expression of this protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.