Rnf138 (NM_001303011) Mouse Untagged Clone
CAT#: MC226177
Rnf138 (untagged) - Mouse ring finger protein 138 (Rnf138), transcript variant 4
"NM_001303011" in other vectors (1)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Rnf138 |
Synonyms | 2410015A17Rik; 2810480D20Rik; STRIN; Trif; Trif-d |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC226177 representing NM_001303011
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTCCGAGGAACTTTCGGCGGCCACGTCCTACACGGAAGATGATTTCTACTGCCCTGTCTGTCAGGAGG TGCTCAAGACGCCGGTGCGGACCGCGGCCTGTCAGCACGTTTTCTGTAGAAAATGTTTCCTGACTGCAAT GAGAGAAAGTGGAATACATTGTCCCCTATGTCGTGGAAGTGTGACTAGAAGAGAAAGAGCATGTCCGGAA CGGGCCTTAGATCTTGAAAATATCATGAGGAGGTTTTCTGGTAGCTGCAGATGCTGTTCAAAAAAGATTA AATTCTATCGCATGAGACATCATTACAAATCTTGTAAGAAGTATCAGGATGAATATGGTGTTTCTTCTGT CATTCCAAACTTTAAGATTTCTCAAGATTCAGTAAGGAGCAGTTCTTCTGGGCATCCTACCTTTAAGTGT CCCTTATGTCAAGAGTCAAATTTCACCAGACAACGTTTATTGGATCACTGTAATAGTAACCACCTATTTC AGATAGTTCCTGTGAATCTTCAGCTAGATGAGGAAACCCAATATCAAACTGCTGTGGAAGAGTCTTTTCA AGTAAACATGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001303011 |
Insert Size | 573 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001303011.1, NP_001289940.1 |
RefSeq Size | 2746 bp |
RefSeq ORF | 573 bp |
Locus ID | 56515 |
UniProt ID | Q9CQE0 |
Cytogenetics | 18 A2 |
Gene Summary | E3 ubiquitin-protein ligase involved in DNA damage response by promoting DNA resection and homologous recombination. Recruited to sites of double-strand breaks following DNA damage and specifically promotes double-strand break repair via homologous recombination. Two different, non-exclusive, mechanisms have been proposed. According to a report, regulates the choice of double-strand break repair by favoring homologous recombination over non-homologous end joining (NHEJ): acts by mediating ubiquitination of XRCC5/Ku80, leading to remove the Ku complex from DNA breaks, thereby promoting homologous recombination. According to another report, cooperates with UBE2Ds E2 ubiquitin ligases (UBE2D1, UBE2D2, UBE2D3 or UBE2D4) to promote homologous recombination by mediating ubiquitination of RBBP8/CtIP. Together with NLK, involved in the ubiquitination and degradation of TCF/LEF. Also exhibits auto-ubiquitination activity in combination with UBE2K. May act as a negative regulator in the Wnt/beta-catenin-mediated signaling pathway.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (4) lacks two alternate in-frame exons in the 3' coding region, compared to variant 1. The resulting protein (isoform 4) is shorter than isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MR228388 | Rnf138 (myc-DDK-tagged) - Mouse ring finger protein 138 (Rnf138), transcript variant 4 |
USD 330.00 |
{0} Product Review(s)
Be the first one to submit a review