Chtop (NM_001293780) Mouse Untagged Clone

CAT#: MC226098

Chtop (untagged) - Mouse chromatin target of PRMT1 (Chtop), transcript variant 6


  "NM_001293780" in other vectors (1)

Reconstitution Protocol

USD 330.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Chtop"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Chtop
Synonyms 2500003M10Rik; Fop; Srag
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226098 representing NM_001293780
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCTGAAGAACAAACAGCCGATGCCAGTGAATATTCGGGCTTCGATGCAGCAGCAGCAGCAGCTAGCCA
GTGCCAGAAACAGAAGACTGGCCCAGCAGATGGAGAATAGACCCTCTGTCCAGGCAGCATTAAAACTTAA
GCAGAAGAGCTTAAAGCAGCGCCTGGGTAAGAGTAATATCCAGGCACGGTTAGGCCGACCCATAGGTGCC
CTGGCCAGGGGAGCAATTGGAGGAAGAGGCCTACCCATAATCCAGAGAGGCTTGCCCCGAGGAGGACTAC
GTGGGGGACGTGCTACCAGAACCCTGCTTAGGGGTGGGATGTCGCTCCGAGGTCGGGGTATGATAGGTCG
GGGAAGAGGGGGCTTTGGAGGCAGAGGCCGAGGTCGTGGCCGAGGGAGAGGTGCCCTCACTCGCCCTGTA
TTGACCAAGGAGCAGCTGGACAACCAATTGGATGCATACATGTCGAAAACTAAAGGACACCTGGATGCTG
AATTGGATGCCTACATGGCACAGACAGATCCTGAAACCAATGATTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001293780
Insert Size 537 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001293780.1, NP_001280709.1
RefSeq Size 3583 bp
RefSeq ORF 537 bp
Locus ID 66511
Cytogenetics 3 F1
Gene Summary Plays an important role in the ligand-dependent activation of estrogen receptor target genes (By similarity). May play a role in the silencing of fetal globin genes (PubMed:20688955). Recruits the 5FMC complex to ZNF148, leading to desumoylation of ZNF148 and subsequent transactivation of ZNF148 target genes (PubMed:22872859). Required for the tumorigenicity of glioblastoma cells. Binds to 5-hydroxymethylcytosine (5hmC) and associates with the methylosome complex containing PRMT1, PRMT5, MEP50 and ERH. The CHTOP-methylosome complex associated with 5hmC methylates H4R3 and transactivates genes involved in glioblastomagenesis (PubMed:25284789).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (6) differs in the 5' UTR and has multiple differences in the coding region, but maintains the reading frame compared to variant 1. One of these differences results in translation initiation at a downstream start codon compared to variant 1. The encoded isoform (6) has a shorter N-terminus compared to isoform 1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.