Mkks (NM_001286983) Mouse Untagged Clone
CAT#: MC226091
Mkks (untagged) - Mouse McKusick-Kaufman syndrome (Mkks), transcript variant 4
"NM_001286983" in other vectors (1)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Mkks |
Synonyms | 1300013E18Rik; AI463362; AI957237; Bbs; Bbs6 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC226091 representing NM_001286983
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCACGTCTTGCAGTTAACAATCAAGGAACCGTGGGTTTTATTGGGAGGTGGCTGTACAGAAACACACT TGGCTGCATATGTCAGACACAAGGTTCATCACGAGGCAGAAGCTATTGTCAGAGATGATGGGTGTACTCA GGCAAAGCTGCATGTTGCTGCTGAAGCATTTTGCAGTGCTCTGGAGTCCGTTGCTGGCTCTTTGGAACAT GATGGTGGTGAAATCCTCATTGACACGAAGTATGGACACCTTTGGTCCTGTCAAGCAGATTCTGCCTCTG TTGGTAACTGGTCAGATACGCTGTCACGGTGTGGCTGTGGTTTGTACAACAGCCAGGAAGAGCTCAGCTG GTCTGTCTTAAGAAGTACTTATCATCCTTTTGCACCACAAACCTGCCTTCCACAGGCAGCTTTGGGCTCA GCCAGTAACCTGACTGTGGACTGCTTCACTGCCAAGCTGAGTGGCTTACAGGTGGCTGTAGAGACAGCCA ATTTGATTTTAGATCTTTCATATGTCATTGAAGATAAAAACTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001286983 |
Insert Size | 534 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001286983.1, NP_001273912.1 |
RefSeq Size | 1831 bp |
RefSeq ORF | 534 bp |
Locus ID | 59030 |
Cytogenetics | 2 F3 |
Gene Summary | This gene encodes a protein which shares sequence similarity with other members of the type II chaperonin family. The encoded protein is a centrosome-shuttling protein and plays an important role in cytokinesis. This protein also interacts with other type II chaperonin members to form a complex known as the BBSome, which involves ciliary membrane biogenesis. This protein is encoded by a downstream open reading frame (dORF). Several upstream open reading frames (uORFs) have been identified, which repress the translation of the dORF, and two of which can encode small mitochondrial membrane proteins. Alternatively spliced transcripts encoding distinct isoforms have been found for this gene. [provided by RefSeq, Nov 2013] Transcript Variant: This variant (4) lacks an internal exon, which results in a downstream start codon compared to variant 1. The resulting isoform (3) has a shorter N-terminus, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MR228302 | Mkks (myc-DDK-tagged) - Mouse McKusick-Kaufman syndrome (Mkks), transcript variant 4 |
USD 330.00 |
{0} Product Review(s)
Be the first one to submit a review