Rgs19 (NM_001291210) Mouse Untagged Clone
CAT#: MC225753
Rgs19 (untagged) - Mouse regulator of G-protein signaling 19 (Rgs19), transcript variant 7
"NM_001291210" in other vectors (1)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Rgs19 |
Synonyms | 2610042F04Rik; AI324841; AW547781; GAIP |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC225753 representing NM_001291210
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCATAGCCCCACGGGCCGCAGTGTATTCCGGGCATTCCTGCGCACAGAATACAGCGAAGAGAACATGC TCTTCTGGCTGGCTTGTGAGGAGTTGAAAGCAGAGGCCAACCAACATGTGGTGGACGAGAAGGCGCGACT TATCTATGAGGACTACGTGTCCATCCTGTCCCCCAAGGAGGTAAGCCTGGACTCCCGTGTGCGAGAAGGC ATCAATAGGAAGATGCAAGAGCCATCGCCACACACATTTGATGATGCACAGCTGCAGATCTACACCCTCA TGCACCGGGACTCGTACCCTCGATTCCTTACCTCCCCCACCTACCGCTCTCTATTACTCCAGGGGGCCCC ACAGTCCTCTGAGGCCTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001291210 |
Insert Size | 369 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001291210.1, NP_001278139.1 |
RefSeq Size | 1286 bp |
RefSeq ORF | 369 bp |
Locus ID | 56470 |
UniProt ID | Q9CX84 |
Cytogenetics | 2 103.72 cM |
Gene Summary | Inhibits signal transduction by increasing the GTPase activity of G protein alpha subunits thereby driving them into their inactive GDP-bound form. Binds to G-alpha subfamily 1 members, with the order G(i)a3 > G(i)a1 > G(o)a >> G(z)a/G(i)a2. Activity on G(z)-alpha is inhibited by phosphorylation and palmitoylation of the G-protein (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (7) contains an alternate 5' terminal exon and lacks two internal exons, and it thus differs in the 5' UTR and initiates translation at a downstream in-frame start codon, compared to variant 1. The encoded isoform (e) is shorter at the N-terminus, compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MR227964 | Rgs19 (myc-DDK-tagged) - Mouse regulator of G-protein signaling 19 (Rgs19), transcript variant 7 |
USD 165.00 |
{0} Product Review(s)
Be the first one to submit a review