Sh3kbp1 (NM_001290664) Mouse Untagged Clone

CAT#: MC225684

Sh3kbp1 (untagged) - Mouse SH3-domain kinase binding protein 1 (Sh3kbp1), transcript variant 5

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Sh3kbp1 (NM_001290664) Mouse Untagged Clone
Symbol Sh3kbp1
Synonyms 1200007H22Rik; 1700125L08Rik; 5830464D22Rik; AI447724; Cin85; IN85; Ruk; Seta
Vector pCMV6-Entry
Sequence Data
>MC225684 representing NM_001290664
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCAGCTGCCAGCAGTGGGCCAGCTTCTCTCTCTTCAGTGGCATCCTCACCCATGTCATCCTCTTTGG
GAACAGCTGGACAGAGAGCCAGTTCTCCATCTCTGTTCAGCACAGAAGGAAAGCCAAAGATGGAGCCAGC
AGTGAGCAGCCAGGCTGCTATCGAGGAGCTTAAGATGCAAGTCCGTGAGCTGAGGACCATCATTGAGACC
ATGAAGGACCAGCAGAAACGTGAGATTAAGCAGTTACTGTCAGAATTGGATGAAGAGAAAAAGATCCGGC
TCCGGTTGCAGATGGAAGTGAACGACATAAAGAAAGCTCTTCAATCAAAGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Chromatograms CHROMATOGRAMS
Sequencher program is needed, download here.
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001290664
ORF Size 333 bp
Insert Size 333
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001290664.1, NP_001277593
RefSeq Size 3721
RefSeq ORF 333
Locus ID 58194
Cytogenetics X|X F4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.