Gngt2 (NM_001284397) Mouse Untagged Clone

CAT#: MC225508

Gngt2 (untagged) - Mouse guanine nucleotide binding protein (G protein), gamma transducing activity polypeptide 2 (Gngt2), transcript variant 4


  "NM_001284397" in other vectors (1)

Reconstitution Protocol

USD 165.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Gngt2"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Gngt2
Synonyms AV096488
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC225508 representing NM_001284397
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCCCAGGACCTCAGTGAGAAGGAGCTGTTGAGGATGGAGGTGGAGCAGCTGAAGAAGGAAGTGAAGA
ACCCACGTGATCTGATTTCCAAGACAGGAAAGGAAATCAAGGATTATGTAGAGGCCCAAGCAGGGACAGA
CCCTCTTCTCAAAGGCATCCCAGAAGACAAGAATCCCTTCAAGGAGAAAGGCACTTGTGTGCTAAGCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001284397
Insert Size 210 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001284397.1, NP_001271326.1
RefSeq Size 587 bp
RefSeq ORF 210 bp
Locus ID 14710
UniProt ID Q61017
Cytogenetics 11 59.01 cM
Gene Summary Guanine nucleotide-binding proteins (G proteins) are involved as a modulator or transducer in various transmembrane signaling systems. The beta and gamma chains are required for the GTPase activity, for replacement of GDP by GTP, and for G protein-effector interaction.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (4) has an alternate 5' UTR exon and also lacks an internal segment in the 5' UTR, compared to variant 3. variant 3. Variants 1, 2, 3 and 4 encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.