Myh14 (NM_028021) Mouse Untagged Clone

CAT#: MC225105

Myh14 (untagged) - Mouse myosin, heavy polypeptide 14 (Myh14), (10ug)

USD 3,173.00


Availability*
13 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Myh14 (NM_028021) Mouse Untagged Clone
Symbol Myh14
Synonyms 2400004E04Rik; II-C; NHMCII; NMHC II-C
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>MC225105 representing NM_028021
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCTGCAGTGACCATGTCCGTGTCTGGGAGGAAGGTAGCCTCCAGGCCAGGCCCGGTGCCTGAGGCAG
CCCAATCGTTCCTCTACGCGCCCCGGACGCCAAATGTAGGTGGCCCTGGAGGGCCACAGGTGGAGTGGAC
AGCCCGGCGCATGGTGTGGGTGCCCTCGGAACTGCATGGGTTCGAGGCAGCAGCCCTGCGGGATGAAGGG
GAGGAGGAGGCAGAAGTGGAGCTGGCGGAGAGTGGGCGCCGCCTGCGGCTGCCCAGGGACCAGATCCAGC
GCATGAACCCACCCAAGTTCAGCAAGGCAGAAGATATGGCTGAGCTCACCTGCCTCAACGAGGCCTCGGT
CCTGCACAACCTGCGAGAACGCTACTACTCCGGGCTCATTTATACCTACTCTGGCCTCTTCTGTGTGGTC
ATTAACCCATACAAGCAGCTGCCCATCTACACGGAGGCCATTGTTGAAATGTACCGGGGCAAGAAGCGCC
ATGAGGTGCCACCTCACGTGTATGCTGTGACGGAGGGCGCGTACCGCAGCATGCTTCAGGATCGTGAGGA
TCAATCCATTCTCTGCACGGGAGAGTCTGGCGCTGGGAAGACGGAGAACACCAAGAAGGTCATCCAGTAC
CTGGCCCATGTGGCATCATCTCCAAAGGGCAGGAAGGAGCCTGGTGTCCCTGGGGAGCTAGAGCGTCAGC
TTCTTCAAGCCAACCCCATCCTAGAAGCCTTTGGCAATGCCAAGACGGTGAAGAACGACAACTCTTCCCG
ATTTGGCAAATTCATCCGCATCAACTTTGATATTGCTGGCTACATCGTGGGAGCAAACATCGAGACCTAT
CTGTTGGAGAAGTCCCGGGCCATCAGACAGGCCAAGGATGAATGCAGCTTCCATATCTTCTACCAGCTGC
TAGGGGGCGCTGGGGAGCAGCTAAAAGCTGACCTCCTTCTGGAGCCCTGTTCCCATTATCGCTTCCTGAC
CAATGGGCCCTCATCGTCCCCGGGCCAGGAGCGTGAGTTATTCCAGGAGACCCTGGAGTCCCTGCGTGTG
CTGGGCCTCCTCCCAGAAGAGATCACTGCCATGCTGCGCACTGTCTCTGCTGTCCTCCAGTTTGGCAACA
TTGTCCTGAAGAAAGAGCGCAATACGGACCAAGCCACCATGCCTGACAACACAGCTGCCCAGAAGCTTTG
CCGCCTCTTGGGACTCGGAGTGACCGACTTCTCCAGAGCCCTTCTCACACCCCGCATCAAAGTGGGCCGA
GATTATGTTCAGAAAGCACAAACCAAGGAGCAGGCTGACTTTGCGCTGGAGGCTCTGGCCAAAGCTACCT
ATGAGCGCCTGTTCCGCTGGCTGGTTCTGCGGCTCAACCGTGCCCTGGACAGAAGCCCGCGGCAGGGTGC
CTCCTTCCTGGGCATCCTGGACATCGCGGGCTTTGAGATCTTCCAGCTGAACTCCTTCGAGCAGCTGTGC
ATCAACTACACCAACGAGAAGCTACAGCAGCTATTCAACCACACCATGTTCGTGCTGGAGCAGGAGGAGT
ACCAGCGAGAGGGCATCCCCTGGACCTTCCTAGACTTCGGGTTGGACCTGCAACCTTGCATCGACCTCAT
TGAGCGTCCGGCCAACCCTCCAGGTCTCCTGGCCCTGCTGGACGAGGAGTGCTGGTTCCCCAAGGCCACG
GACAAGTCTTTTGTGGAGAAGGTTGCCCAGGAGCAGGGCAGCCACCCCAAGTTCCAGCGCCCCAGGAACC
TGCGAGATCAGGCCGACTTCAGCGTCCTGCACTATGCCGGCAAGGTTGACTACAAAGCCAGTGAGTGGCT
GATGAAGAACATGGACCCACTGAATGACAATGTGGCCGCCTTGCTTCACCAGAGCACGGATCGTCTCACA
GCTGAGATCTGGAAGGATGTGGAGGGCATCGTGGGGCTGGAGCAAGTAAGCAGCCTTGGAGATGGCCCAC
CGGGAGGCCGCCCCCGCCGTGGAATGTTCCGGACTGTGGGGCAGCTCTACAAAGAATCCCTGAGCCGCCT
CATGGCCACGCTCAGCAACACCAACCCTAGTTTTGTCCGCTGCATCGTTCCCAATCATGAGAAGAGGGCT
GGAAAGCTGGAGCCGCGCCTGGTGCTGGACCAACTCCGTTGTAACGGGGTCCTCGAGGGTATCCGCATCT
GTCGCCAAGGCTTCCCCAACCGCATCCTCTTCCAGGAGTTCCGACAGCGCTATGAAATCCTCACCCCGAA
CGCTATTCCCAAGGGCTTCATGGACGGCAAACAGGCCTGTGAGAAGATGATCCAGGCCCTGGAGCTAGAC
CCCAACCTGTACCGTGTTGGCCAAAGCAAGATCTTCTTCCGGGCAGGGGTCCTGGCCCAGCTGGAGGAGG
AGCGGGACCTGAAAGTCACCGACATCATAGTGTCTTTCCAGGCAGCGGCACGGGGCTACCTGGCCCGTAG
GGCTTTCCAGAGACGGCAGCAGCAGCAGAGTGCTCTGAGGGTGATGCAGAGAAACTGTGCTGCCTACCTC
AAGCTCAGGAACTGGCAGTGGTGGAGGCTGTTCATCAAGGTGAAGCCCCTGCTGCAGGTGACACGGCAGG
ATGAGGTGCTGCAGGCGCGCGCCCAGGAGCTGCAGAAAGTTCAGGAGCTGCAGCAGCAGAGCGCTCGTGA
AGTGGGGGAACTGCAGGGTCGAGTGGCACAGCTAGAGGAGGAGCGCACGCGCCTGGCTGAGCAGCTTCGA
GCAGAAGCCGAGCTCTGCTCTGAGGCCGAGGAGACGCGGGCGCGACTGGCTGCCCGGAAGCAGGAGCTGG
AGCTGGTGGTGACAGAGCTGGAGGCACGAGTGGGCGAGGAAGAAGAGTGCAGCCGGCAGCTGCAGAGTGA
GAAGAAGAGGCTGCAGCAGCATATCCAGGAGCTAGAGAGCCACCTGGAAGCTGAGGAGGGTGCCCGGCAG
AAGCTACAGCTGGAGAAGGTGACCACAGAGGCCAAGATGAAGAAATTTGAGGAGGACCTGCTGCTCCTGG
AGGACCAGAATTCCAAGCTGAGCAAGGAGCGGAGGCTGCTGGAGGAGCGGCTGGCTGAGTTCTCCTCACA
GGCAGCAGAAGAGGAAGAGAAAGTCAAAAGTCTCAACAAGCTGAGGCTCAAATATGAAGCCACAATCTCA
GACATGGAAGACCGGCTGAAGAAGGAGGAGAAGGGACGCCAGGAACTAGAGAAGCTGAAGCGACGGCTGG
ACGGGGAGAGCTCAGAGCTTCAGGAGCAGATGGTGGAGCAGAAGCAGAGGGCAGAGGAACTGCTCGCACA
GCTGGGCCGCAAGGAGGATGAGCTGCAGGCCGCCCTGCTCAGGGCAGAGGAAGAGGGTGGTGCCCGTGCC
CAGTTGCTCAAGTCCCTGCGAGAGGCACAGGCTGGCCTTGCTGAGGCTCAGGAGGACCTGGAAGCTGAGC
GGGTAGCCAGGGCCAAGGCGGAGAAGCAGCGCCGGGACCTGGGCGAGGAGTTGGAGGCCCTACGTGGGGA
GCTCGAGGACACTCTGGATTCCACCAACGCCCAGCAGGAGCTGCGGTCCAAGAGGGAGCAGGAGGTGACA
GAGCTGAAGAAAGCATTGGAAGAGGAGTCCCGTGCCCATGAGGTGTCCATGCAGGAGCTGAGACAGAGGC
ATAGCCAGGCACTGGTGGAGATGGCCGAGCAGTTGGAGCAAGCCCGGAGGGGCAAAGGTGTGTGGGAGAA
GACTCGGCTATCCCTGGAGGCTGAGGTGTCCGAGCTGAAGGCCGAGCTGAGCAGCCTGCAGACCTCGAGA
CAGGAGGGTGAGCAGAAGAGGCGCCGCCTGGAGTCCCAGCTACAGGAGGTCCAGGGCCGATCCAGTGATT
CGGAGCGGGCTCGGTCTGAGGCTGCTGAGAAGCTGCAGAGAGCCCAGGCGGAACTTGAGAGCGTGTCCAC
AGCCCTGAGTGAGGCGGAGTCCAAAGCCATCAGGCTGGGCAAGGAGCTGAGCAGTGCAGAGTCCCAGCTG
CATGACACCCAGGAACTGCTTCAGGAGGAGACCAGGGCAAAGCTGGCCTTGGGGTCCCGTGTGCGTGCCC
TAGAGGCCGAGGCGGCGGGGCTTCGGGAGCAGATGGAAGAGGAGGTGGTTGCCAGGGAACGGGCTGGCCG
GGAGCTGCAGAGCACGCAGGCCCAGCTCTCTGAATGGCGGCGCCGCCAGGAAGAAGAGGCCGCGGTGCTG
GAGGCTGGGGAGGAGGCTCGGCGCCGTGCAGCCCGGGAGGCAGAGACCCTGACCCAGCGCCTGGCAGAAA
AGACTGAGGCTGTAGAACGACTGGAGCGAGCCCGGCGCCGACTGCAGCAGGAGTTGGACGATGCCACTGT
GGATCTGGGGCAGCAGAAGCAGCTCCTGAGCACACTGGAGAAGAAGCAGCGGAAATTTGACCAGCTCCTG
GCAGAGGAGAAGGCTGCAGTTCTACGGGCTGTGGAAGACCGTGAACGGATAGAGGCCGAAGGCCGGGAGC
GAGAGGCCCGGGCCCTGTCGCTGACCCGGGCCCTGGAAGAGGAGCAGGAGGCCCGGGAGGAGCTGGAGAG
GCAGAACCGTGCTCTGAGGGCTGAGCTGGAAGCACTGCTGAGCAGCAAGGATGACGTGGGCAAGAACGTG
CACGAGCTGGAGCGAGCCCGTAAGGCGGCTGAACAGGCAGCCAGTGACCTGCGGACACAGGTGACAGAAT
TGGAGGATGAGCTGACAGCCGCAGAGGATGCCAAGCTGCGCCTGGAGGTGACTGTGCAGGCTCTGAAGGC
TCAACATGAACGCGACCTGCAGGGCCGCGATGATGCCGGTGAGGAGAGGCGGAGGCAGCTGGCCAAGCAG
CTAAGAGACGCAGAGGTAGAGCGCGATGAGGAACGGAAGCAGAGGGCACTGGCTATGGCTGCCCGCAAGA
AGCTGGAGCTGGAACTGGAGGAGTTGAAGGCGCAGACATCTGCTGCTGGGCAGGGCAAGGAAGAGGCAGT
GAAGCAGCTGAAGAAGATGCAGGTCCAGATGAAGGAGCTGTGGCGGGAGGTAGAGGAGACGCGTAGCTCC
CGCGACGAGATGTTTACCCTGAGCAGGGAAAATGAGAAGAAGCTCAAGGGGCTGGAAGCTGAGGTGCTGC
GTCTGCAAGAGGAACTTGCTGCCTCAGACCGAGCCCGGAGGCAGGCCCAGCAAGACAGAGACGAGATGGC
AGAGGAGGTGGCCAGTGGCAATCTTAGCAAGGCAGCCACCCTGGAGGAAAAACGGCAGCTGGAGGGGCGA
CTGAGCCAGTTGGAAGAGGAGCTGGAGGAAGAACAGAACAACTCGGAGCTGCTCAAGGACCATTACCGAA
AGCTAGTGCTACAGGTCGAGTCCCTCACCACAGAACTGTCTGCCGAACGAAGTTTCTCAGCCAAGGCCGA
GAGTGGACGGCAGCAGCTGGAGCGGCAGATCCAGGAACTGCGGGCCCGCTTGGGTGAAGAGGATGCTGGA
GCCCGAGCCAGGCAGAAAATGCTGATCGCTGCTCTGGAGTCTAAACTGGCCCAGGCAGAGGAGCAGCTGG
AGCAGGAGAGCAGGGAGCGCATCCTCTCTGGCAAGCTGGTACGCAGAGCTGAGAAGCGGCTGAAGGAGGT
AGTTCTTCAGGTGGATGAAGAGCGCAGGGTGGCTGACCAGGTCCGGGACCAGCTGGAGAAAAGCAACCTC
CGGCTGAAGCAGCTCAAGAGGCAGCTGGAGGAGGCAGAGGAGGAGGCATCTCGGGCACAGGCTGGTCGGA
GGCGGCTGCAGCGGGAGCTGGAGGACGTCACTGAGTCTGCAGAATCCATGAACCGGGAGGTGACCACGCT
GAGGAACAGGCTCCGGCGTGGCCCACTTACATTCACCACACGGACTGTGCGCCAGGTGTTCCGGCTGGAA
GAGGGCGTGGCTTCTGACGAGGAAGAGGCTGAAGGAGCTGAACCTGGCTCTGCACCAGGCCAGGAGCCGG
AGGCTCCGCCCCCTGCCACACCCCAATGA


AGCGGACCGACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCC
TGGATTACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-RsrII     
Tag Tag Free
ACCN NM_028021
ORF Size 5979 bp
Insert Size 5979
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_028021.3, NP_082297
RefSeq Size 6392
RefSeq ORF 5979
Locus ID 71960
Cytogenetics 7|7 B3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.