Kif13b (NM_001081177) Mouse Untagged Clone

CAT#: MC224971

Kif13b (untagged) - Mouse kinesin family member 13B (Kif13b), (10ug)

  View "NM_001081177" in other vectors (2)

USD 3,020.00


Availability*
7 Weeks

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name Kif13b (NM_001081177) Mouse Untagged Clone
Symbol Kif13b
Synonyms 5330429L19Rik; 6030414C01; AI429803; C130021D12Rik; GAKIN
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Cell Selection Neomycin
Sequence Data
>MC224971 representing NM_001081177
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGGAGACTCCAAAGTGAAAGTGGCGGTACGGGTCCGGCCAATGAACCGACGAGAAATTGACTTACATA
CCAAATGTGTGGTGGATGTTGAAGCGAACAAAGTTATTCTGAATCCTGTAAATACAAATCTTTCCAAAGG
AGATGCCCGGGGCCAGCCAAAGATCTTTGCTTATGATCACTGTTTCTGGTCCATGGATGAATCTGTCCGA
GAGAAGTATGCAGGTCAAGAAGATGTTTTCAAGTGCCTTGGGGAGAACATTCTTCAGAATGCATTTGATG
GCTACAACGCCTGTATCTTTGCTTATGGGCAGACAGGGTCTGGAAAGTCTTACACCATGATGGGCACTGC
TGACCAACCTGGATTAATCCCAAGGCTCTGTAGTGGACTCTTTGAACGAACCCAGAAAGAGGAAAATGAA
GAACAGAGTTTTAAAGTCGAAGTGTCGTACATGGAAATTTATAATGAAAAAGTCCGAGACCTTCTTGACC
CCAAAGGAAGCCGTCAGACGTTGAAAGTGAGAGAGCACAGTGTGTTGGGACCCTACGTGGATGGACTTTC
TAAACTGGCTGTCACAAGCTACAAGGATATTGAGTCTCTGATGTCTGAGGGCAACAAGTCTCGGACAGTT
GCTGCAACCAACATGAACGAGGAAAGTAGCCGTTCCCATGCAGTCTTCAAAATCACCCTGACACATACTC
TGTATGATGTGAAGTCTGGGACATCTGGAGAGAAAGTGGGCAAGCTGAGCTTAGTGGATTTAGCTGGCAG
TGAACGAGCCACGAAAACCGGAGCTGCGGGCGACAGGCTGAAGGAGGGCAGCAACATCAACAAGTCCCTC
ACAACCCTGGGTCTGGTTATCTCTGCCCTAGCTGATCAGGGTGCTGGCAAAAACAAAAATAAATTTGTTC
CCTATCGGGACTCAGTTCTCACATGGCTGCTCAAGGACAGTCTGGGAGGTAATAGCAAGACTGCCATGGT
GGCCACTGTGAGCCCCGCTGCAGATAACTATGACGAAACCCTCTCAACCCTGAGGTACGCAGATCGAGCA
AAGCACATCGTCAACCATGCTGTGGTGAATGAGGATCCGAATGCTCGGATTATCCGAGATCTGCGGGAGG
AGGTGGAGAAGCTCCGGGAGCAGCTGACCAAGGCAGAGGCAATGAAATCTCCAGAGCTGAAAGATCGTCT
GGAAGAATCGGAGAAACTCATCCAGGAAATGACTGTGACCTGGGAGGAGAAACTAAGGAAAACTGAGGAG
ATTGCGCAGGAGCGGCAAAAGCAGCTTGAGAGCCTTGGCATATCTCTTCAGACTTCTGGAATCAAGGTTG
GGGATGACAAGTGCTTCCTGGTTAACCTGAATGCTGACCCAGCTCTGAATGAACTCCTGGTGTACTACTT
AAAGGAGCACACGCTGATAGGGTCGGCCAATTCTCAGGACATCCAGCTCTGCGGGATGGGCATCCTCCCT
GAGCACGGCATCATAGACATCACGCCCGAGGGCCAGGTTGTGCTGACTCCTCAGAAGAACACCAGAACAT
TTGTCAATGGGTCTTCTGTCTCCAGCCCCATCCAGCTGCACCATGGGGACAGGATACTGTGGGGAAACAA
CCATTTCTTCAGACTCAATCTGCCAAAAAAGAAAAAGAAAGCAGAGCGAGAGGACGAGGACCGTGAGGCA
TCCCTGAAAAACGACAGTAGTTCTGAGCAGCTGGATGCCGACGGCGACTCCTCCAGTGAGGTGTCCAGCG
AGATCAACTTCAACTTTGAGTATGCACAGATGGAGGTGACCATGAAGGCTCTGGGCAGCAATGACCCAAT
GCAGTCCATACTGAGCAGCCTAGAACAGCAGCATGAGGAGGAGAAGCGGTCTGCTCTGGAGCGCCAGAGG
CTCATGTACGAACACGAACTGGAACAGCTTCGAAGAAGGCTGTCTCCTGAGAGGCAGAACTGCCGCGGTG
TGGACCGGCTCTCCTTCCACTCGCCCAGTGCCCAGCAGCGCTTGAAACAGTGGGCTGAAGAGAGAGAAGC
AACATTGAATAACAGCTTGATGAGGCTGAGGGAGCAGATTGTAAAGGCCAACCTGCTGGTTCGGGAAGCT
AGTTACATCGCAGAAGAGTTGGATAAAAGAACCGAGTATAAAGTTACCCTCCAGATTCCAACCTCCAGTC
TGGATGCCAATAGGAAGCGAGGCTCTCTCCTCAGTGAACCTGCCATCCAGGTGAGAAGAAAGGGCAAAGG
AAAGCAGATTTGGTCTTTGGAAAAGCTGGAAAACAGGCTTTTGGATATGAGAGACCTCTACCAGGAGTGG
AAGGAGTGTGAAGAAGACAGCCCGGTTAGCCGGTCCTACTTCAAGCGTGCTGACCCATTCTATGATGAGC
AGGAAAACCATAGTCTCATCGGTGTGGCCAATGTCTTCCTGGAGACCCTGTTTTATGACGTGAAGTTACA
GTATGCTGTGCCGATCATCAACCAGAAGGGAGAGGTGGCAGGCCGGCTGCACGTGGAGGTGATGCGACTC
AGTGGGGCTATTGGGGAGAGGATTGCAGGAGGAGACGATCCTACAGAGGTCAGCTCTGAAAAGGAAGCCC
AGGAGAACAGGCTGGTCTGCATGGTTAAAATACTCCAAGCCACAGGGTTGCCGCAGCATCTGTGTCACTT
TGTCTTCTGCAAATATGACTTCTGGGATCAGCAGGAGCCAGTGACCGTTGCCCCTGAAGTGGATACGTCT
TCGTCTCCCACCAGCAAGCAGCCACAGTGTATGGTTGTGTTCGATCACTGCAGTGAGTTCAGTGTTAACA
TCACAGAAGACTTCATTGAATATCTCTCAGAAGGGGCCCTAGCCATTGAAGTATATGGACATAAAATGAA
TGATCCCCGGAAAAACCCAGCCCTGTGGGACTTGGGGATCATCCAAGCAAAAACAAGGAGTCTTCGGGAC
AGGTGGAGTGAAGTCACCAGAAAGTTGGAATTCTGGGTTCAGATCTTGGAACAGAATGAGAATGGTGATT
ACTGTCCGGTGGAAGTAATTGCTGCAAAAGATGTCCCCACAGGAGGGATCTTCCAGCTCCGACAGGGGCA
GTCTCGGCGAGTTCAAGTTGAAGTGAAGTCTGTGCAGGAGTCAGGAACTTTACCACTGATGGAAGAGTGC
ATATTGTCAGTTGGCATTGGGTGTGTGAAAGTTAGGCCACTCCGGTCCCCTAAGATCCACGAGAATGTCC
ATGAGGAAGAGGAGGACATGGACAGCTACCAGGATAGGGATTTAGAGCGGCTTCGTAGAAAATGGCTCAA
TGCATTAACCAAACGTCAAGAATACTTGGATCAACAACTGCAGAAGCTTGTCAGTAAACATGACAAAACT
GAGGATGATGCTGACCGAGAGGCACAGCTCCTGGAGATGCGGCTGACGCTCACAGAGGAAAGAAATGCAG
TGATGGTGCCTTCTGCTGGGAGTGGCATTCCAGGGGCCCCTGCAGAATGGACCCCAGTGCCTGGGATGGA
GACCCACATTCCTGTTATATTTCTTGACTTAAATGCGGATGATTTCAGCTCTCAGGATAATCTCGATGAC
CCAGAAGCAGGATGGGATGCTACCCTGACTGGGGAAGAGGAGGAGGAGTTCTTTGAGCTGCAGATTGTGA
AACAACACGATGGAGAGGTGAAGGCAGAGGCCTCCTGGGACTCTGCAGTGCACAGCTGTCCTCAACTCAG
TAAGGGCACACCTGCTGACGAGCGAGTGTTCCTCATCCTGCGAGTGACTGTCCAGCTCAGCCATCCTGCC
GACATGCAGCTGGTCCTACGCAAGAGGATTTGTGTCCATGTTCATGGGCGCCAGGGCTTTGCTCAAAGTC
TCCTCAAAAAGATGTCTCACCGGAGCTCTATTCCTGGCTGTGGAGTGACCTTTGAAATCGTCTCCAATAT
TCCAGAGGATGCCCAGGGAGTGGAGGAGCGAGAGGCACTGGCAAGGATGGCAGCTAACGTGGAAAACCCA
GCATCTGCTGACTCCGAGGCCTATATTGAGAAGTACTTGAGGAGTGTGCTGGCCGTGGAAAACCTCCTGA
CTTTAGATCGCCTGCGTCAGGAAGTGGCCGTGAAGGAGCAGCTGACGGGGAAGGGGAAGCTGAGCCGAAG
GAGTATCAGCTCCCCCAGCATGAACAGATTGTCAGGAAGCCGGCAGGAGCTTAGCCCATCCCACAGTCTA
GGCAGCAACAAGGGCCGGTGGGAAAGTCAACAGGATGTGTCCCAAACACTAGTTTCCAGAGGAATAGCTC
CAGGCCCTCCAGCTCTCTCTGTTTCGCCCCAAAATAACCAGTCTCCTGATCCTGGACTGGGAGGCGTGGC
AGCCTCTTACTTGAACCCAGTGAAGTCCCTGGTGCCACAGATGCCAAAGCTGCTGAAGTCTCTCTTCCCT
GTTCGGGATGACAGAAGGGGGAGACACTCATCTCCCCTTGCACACCAGCCCGTGCCCCGAATCTTGGTGC
AGCCTACCTTCTCAGATACCTGGGCAACAAGGACAGAGGAGGTGAGTCACCAGGTTGGGGCTGCCCCACT
TGCAGAGGTGATGGCGGCCCCTGCAGTAAAGATCTGTGACAAACCTGTCAAAGTGTCTTCCCCTCCATCT
CCCATGGTGGTTACTCAGCCCCCAGAAGGACAGGATGGACCACCCAGCCCTTTGAGTGAAGCTTCAAGTG
GCTACTTCTCTCACAGTGTCTCTTCTGCCACCCTGTCAGAAACACTCACCTTAGGCCTGGACACCACAGG
CCTCGGCAGCCAGACGCCTGGGTCCCCCCCTGCCCTGTGTCAGGTCACCCCAGAGCCTGAGCTGGCTTTC
CTCTCCTGCACACAAAGCCATCCTCCTGCCCCAGAGGAGGCCCACGTACCTGCAGCTCCTACTCAAAGCA
CAGAGCTGGAGGTTCCCAGAGCACCTCTTCTTTCTGAACCCGCGTCTGCTGTACCCACGTCCCCATTCAG
AATCCGGAAAGTGCGGACCTCAGAGCTTAAGTCCTTCACAGGCATGCTGGGTGGTGCCTCCTCCGGAGCA
GAGGAGGACCCCCTGGCTTCAGAAGACCCCAGCAATGCTAGGGGACAGACTCTGGGGAGGCTAGAAGTAA
CATCTGACTCTGAGGATGCCAGCGAAGTCCCTGAGTGGCTCAGAGAGGGAGAGTATGTTGTTGTGGGCAC
CAACAAGACGGGCATTGTACGGTATATTGGACCAACTGATTTCCAGGAGGGAACATGGATTGGTGTGGAG
CTGGATCTGCCTGCAGGAAAGAATGATGGCTCCATTGGTGGGAAACAGTATTTCAGGTGCAACCCTGGCT
ATGGGCTGCTGGTGAGGCCCAGCCGGGTCCGCAGGGCTGTGGGCACTGGGCGCAGGCGCAGTTCAGGGCT
CCAGCCTCAGGGAGCCCCAGAGGTCCGCAGAAGTGCTACCATCTCGGGCTCTGCCACCAACCTGGCTTCA
CTGACAGCTGCACTGGCCAAGGGAGACAGGAGTTACAAGAATCCTGAGAACCGGAAGTCCTGGGCCAGCT
AA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001081177
ORF Size 5532 bp
Insert Size 5532
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001081177.1, NP_001074646
RefSeq Size 5603
RefSeq ORF 5532
Locus ID 16554
Cytogenetics 14|14 D1

Other Versions

Other products for "Kif13b"
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
40% off proteins and antibodies
68 Mouse Clones