Cttnbp2 (NM_080285) Mouse Untagged Clone

CAT#: MC224788

Cttnbp2 (untagged) - Mouse cortactin binding protein 2 (Cttnbp2), (10ug)

USD 2,102


Availability*
7 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Cttnbp2 (NM_080285) Mouse Untagged Clone
Symbol Cttnbp2
Synonyms 3010022N24Rik; 4732477G22Rik; 6430526E05; 9130022E09Rik; AU040881; Cortbp2; mKIAA1758; ORF4
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>MC224788 representing NM_080285
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCGACGGACAGCGCGAGCTGCGAGCCCGACTTGTCCCGCACCCCGGGTGACACGGAGGGGGCCACGG
CGGAGGCGGCGAAAAAGGAATTTGATGTGGACACGCTCAGCAAATCAGAGCTGCGGATGCTCCTTAGCGT
GATGGAAGGTGAACTAGAAGCCAGAGACCTGGTGATTGAGGCCCTGAGGGCTCGCAGGAAGGAGGTGTTC
ATCCAGGAACGGTATGGGAGGTTTAATCTAAATGACCCCTTCCTGGCACTTCAGAGAGACTATGAAGCAG
GTCCTGGTGACAAAGAGAAGCCAGTCTGCACCAATCCACTCTCCATCCTTGAAGCTGTCATGGCCCACTG
CAGAAAAATGCAAGAAAGGATGTCCGCACAGCTGGTGGCCGCTGAGAGCAGACAAAAAAAGTTGGAGATG
GAAAAGCTCCAGCTCCAGGCCCTTGAACAGGAGCACAAGAAGCTGGCTGCCCACCTGGAGGAAGAGCGGG
GCAAGAACAAGCACGTGGTCCTGATGCTGGTGAAGGAGTGTAAGCAGCTCTCGGGCAAAGTCGTGGAGGA
GGCCCAGAAGCTGGAGGAAGTCATGGCGCAACTGGAGGAGGAAAAGAAAAAGACAAGTGAGTTAGAAGAG
CAGCTCTCAGCTGAGAAACAGAGAAGCTCTGGAATGGAAGCTCAGTTGGAGAAACAGCTCTCCGAGTTTG
ACACGGAACGGGAGCAGCTGCGCGCCAAGCTGAGCCGAGAGGAAGCACACACCACCGACCTCAAAGAGGA
GATAGACAAGATGAAGAAAATGATGGAGCAAATGAAGAAGGGAAGTGATGGCAAGCCCGGCCTCTCCCTC
CCACGGAAGACAAAAGATAAGCGCCTGGCTTCCATATCTGTGGCAACAGAAGGGCCTGTGACAAGGTCCG
TTGCTTGCCAGACAGATGTAGTGACAGAAAGCACTGACCCTGTGAAGAAGTTGCCTTTGACTGTACCCAT
AAAGCCTTCCACAGGGAGCCCCCTAGTTCCCACAAACACAAAAGGGAATGTGGGCCCCAGTGCCCTGCTG
ATTAGACCAGGTATTGATAGGCAGTCTTCCCACAGTGACTTGGGTCCCTCTCCACCTACTGCTCTACCTT
CAAGTGCAAACAGAATTGAGGAGAATGGACCAAGCACAGGCAATGCCCCTGATCTATCAAATAGCACCCC
CTCAACTCCTAGTAGCACTGCCCCTGCCGCTGCTCAGACACCAGGCACAGCACCCCAGAACCACTCACAA
GCTCCTACTGTGCACAGTTTACATTCACCATGTGCCAACACTCATCCAGGCCTCAACCCACGCATCCAAG
CAGCTAGATTCAGATTTCAGGGCAATGCAAATGACCCAGACCAGAATGGAAATAACACTCAAAGCCCTCC
CTCGAGAGATGTCTCTCCTACGAGTCGTGACAACCTAGTAGCCAAGCAGCTAGCTCGGAATACTGTGACC
CAAGCGCTGTCCAGATTTACCAGCCCTCAAGCGGGTGCTTCTTCAAGACTTGGAGTATCTCCAGGAGGGG
ACGCTGGCACCTGCCCTCCAGTTGGTCGAACCGGTTTAAAGACTCCCGGGGCAGCAAGAGTTGACAGAGG
AAATCCTCCTCCTATCCCTCCCAAAAAGCCAGGGCTCTCCCAAACTCCTTCTCCGCCACACCCCCAACTG
AGGGCCTCCAATGCAGGGGCCAAAGTTGATAACAAAATTGTGGCTTCACCTCCCTCTACTTTGCCACAAG
GGACCAAGGTAGTAAATGAGGAGAACGTCCCTAAGTCGTCCTCCCCTCAGCTGCCACCAAAACCGTCCAT
AGATTTAACTGTGGCACCTGCAGGCTGTCCCGTTTCGGCCCTGGCCACGTCTCAGGTGGGTGCCTGGCCT
GCTGGAACCCCTGGACTGAACCAACCCGCATGTTCAGACAGCTCCCTTGTCATTCCCGCCACCGTTGCCT
TTTGCTCTTCCATAAACCCTGTTAGTGCCTCATCCCGTAGCCCCGGTGCCTCAGACAGCCTCTTGGTAGC
AGCATCAGGCTGGTCACCCTCCCTAACCCCTTTGCTAATGAGTGGTGGTCCTGCCCCCCTGGCTGGCAGG
CCCACCCTTCTTCAGCAAGCTGCTGCCCAGGGAAATGTCACTTTATTATCAATGCTGCTTAATGAAGAAG
GACTGGACATAAATTACTCCTGCGAAGATGGCCATTCTGCCTTGTATTCTGCTGCTAAGAATGGACATAC
AGACTGTGTGCGATTGCTGCTGAATGCAGAAGCCCGAGTCGACGCTGCTGATAAAAATGGCTTCACACCC
TTGTGCGTCGCAGCTGCTCAGGGACATTTTGAATGTATAGAATTACTAACTGCATACAATGCCAACATTA
ATCACTCTGCTGCTGGAGGACAGACACCTTTGTACTTGGCCTGTAAAAATGGAAATAAGGAATGTATCAA
ACTCCTGCTGGAAGCTGGCACTGACCGGAGCATAAAAACCAGAGATGGCTGGACGCCAATTCACGCAGCT
GTGGACACTGGTAATGTGGACAGCCTCAAGCTCCTGATGTACCATAGAGTGCGAGCCCATGGAAACTCTT
TGAGTTCAGAAGAGCCCAAGTCAGGCTTGTTCAGCTTGAATGGAGGAGAGAGCCCTACGGGTCCATCTAA
GCCTGTGGTTCCTGCAGACCTAATTAACCACGCTGACAAAGAAGGCTGGACTGCTGCCCACATTGCTGCC
TCCAAAGGTTTCAAGAACTGCCTAGAAGTCTTGTGTAGGCATGGAGGACTAGAGCCGGAAAGGAGAGACA
AGTGCAATCGGACTGTGCACGATGTTGCCACTGATGACTGCAAGCATTTGCTGGAGAATCTGAATGCTCT
TAAAATACCCTTAAGGATTTCCGTGGGTGAGATTCAACCAAGCAACGATGTTTCTGACGACTTTGAATGT
GAACATACGATATGCACTTTAAATATCCGCAAACAGACATCATGGGAAGATTTTTCCAAAGCAGTGAGTC
AGGCTCTGACAAATCATTTCCAAGCCATCTCTTCTGATGGATGGTGGAGTCTGGAAGATGGGACATTTAA
TAATGCTACTGACTCCTGCATCGGTCTTGGCACCAGCAGTATACGATCCATCATGTTAGGAAGTATGCCG
TGGTCAACTGGTCAGAGCTTCTCCCAGTCCCCGTGGGACTTCTTGAAAAAGAAGAAGGTGGAGCAGGTCC
TGGCGCTCTTGTCAGGTCCCCAAGAAGGCTGCCTCAGTAGTGTGACTTACGCATCCATGATCCCACTTCA
GATGCTGCAGAACTACCTCAGGCTGGTTGAGCAATATCATAATGTCATTTTCCATGGACCAGAAGGAAGC
TTGCAAGACTACATAGCAAATCAGCTTGCCCTCTGCATGAAGTACAGACAGATGGCTGCAGGATTCCCCT
GTGAAATAGTGAGAGCCGAGGTGGATTCGGGTTTCTCCAAAGAGCAGCTAGTAGACGTGTTCATCAGGAA
TGCTTGTCTCATCCCAGTGAAGCAGTTCCCTGTTAAGAAGAAAATAATCGTCATCTTGGAAAATTTGGAA
AAATCTTCATTGTCTGAGTTACTGGGGGACTTTCTGGCACCTTTGGAAAATCGCAGCACTGAAAGCCCCT
GCACTTTCCAAAAAGGAAATGGAACATCCGAATGCTATTATTTCCATGAGAACTGCTTTCTGGTGGGAAC
CATTGCCAAAGCCTGTCTCCAGGGCTCTGACCTGCTGGTACAGCAACACTTCCGCTGGGTTCAGCTGCGC
TGGGATTGCGAGCCCATTCAAGGATTGCTTCAGAGGTTCTTACGAAGGAAAGTCGTCAGCAAGTTCAGAG
GTCAGCTGCCTGCACCCTGTGATCCTGTATGTAAGATTGTGGACTGGGCTCTGTCTGTCTGGAGGCAGCT
CAACTCCTGTCTGGCCCGCTTGGGTACACCAGAAGCACTTCTTGGACCAAAGTATTTCCTGTCGTGTCCA
GTAGTCCCGGGACATGCCCAGGCAACAGTGAAGTGGATGTCTAAGCTGTGGAATGCTGTCATTGCTCCCA
GAGTTCAAGAAGCAATATTGTCAAGAGCCTCCATGAACAAACAACCTGGTACTGGGCAGACAGCTTCTAA
GAAGTACCCTAGCCAAGGACAGCAGGCTGTGGTGAGGGCCGCCCTCAGCATTCTGCTTAATAAAGCGGTT
CTGCATGGCTGTCCCCTTCCCAGGGCAGAGCTGGATCAGCAGATCGCAGACTTCAAAGGGGGCAGTTTTC
CTCTGTCAATAGTGTCAAGTTATAGCAAAAAGAAAGTGGAGAGCGGCGCCTGGAGAAAGGTGAACACCAG
TCCTCGAAAGAAGCCTGGGCACTTCTCCTCACCCACGTGGAACAAGCCAGACCCGAAGCGTGAAGGTATG
AGGAACAAGACTATACCACACCTGAATACTAACAGGAACTCCTCTCTGTCGAAGCAACAGTCCTTAGAGA
ATGATCTATCTGTGACATTGACTTTGGACCACAGACTCTCTTTGGGTTCAGATGATGAAGCAGATCTGGT
CAAAGAACTCCAGAGTATGTGTTCCAGCAAATCTGAGTCTGATATAAGTAAGATTGCTGATTCCAGGGAT
GACTTGAGGAAGTTTGATAGTTCAAGAACCAACCCTGGGACTTCAGCACCTCTTAACCTGAGGACACCAG
TGCCACAGAAGGAAGCCAGTCCTCCCAGCAGCCGTCAAACTGCCGAATGCAGCAACAGTAAATCAAAGAC
TGAGATGGGTGTCTCAAGCGTTAAATCTTTTCTTCCTGTTCCTAGAAGCAAAGTCGCTCAGTGTTCCCAG
AACACCAAAAGAAACAGCAGCAGCAGCAATACAAGGCAACTAGAAATCAACAACAACTCCAAAGAAGAGA
ATTGGACCTTAGACAAACACGAACAAGTAGAAAAACCAAACAAATAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_080285
ORF Size 4947 bp
Insert Size 4947
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_080285.1, NP_525024
RefSeq Size 5931
RefSeq ORF 4947
Locus ID 30785
Cytogenetics 6|6 A2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.