Card11 (NM_175362) Mouse Untagged Clone

CAT#: MC223757

Card11 (untagged) - Mouse caspase recruitment domain family, member 11 (Card11), (10ug)

USD 1,473.00


Availability*
6 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Card11 (NM_175362) Mouse Untagged Clone
Symbol Card11
Synonyms 0610008L17Rik; 2410011D02Rik; BIMP3; CARMA1
Vector pCMV6-Entry
Sequence Data
>MC223757 representing NM_175362
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCCAGGAGGAGGGCCAGCTATGGATGACTACATGGAGACGCTGAAGGATGAAGAGGAGGCCCTATGGG
ATAACGTGGAATGCAACCGGCACATGCTGAGCCGTTACATCAACCCCGCCAAGCTCACCCCCTACCTGCG
CCAGTGCAAGGTCATCGATGAGCAAGATGAAGACGAGGTGCTCAATGCGCCCATGCTGCCGTCCAAGATC
AACCGTGCAGGCCGATTGTTGGACATTCTTCACACCAAGGGACAAAGGGGCTATGTGGTCTTCCTGGAGA
GCCTGGAGTTTTACTACCCAGAACTTTACAAACTGGTGACTGGAAAGGAACCCACCCGGAGATTCTCCAC
CATTGTGGTGGAGGAAGGCCATGAGGGCCTCACACACTTCCTGATGAACGAGGTCATCAAACTGCAGCAG
CAAGTGAAAGCCAAGGACCTTCAGCGCTGTGAGCTGCTGGCCAAGTCCCGGCAACTGGAGGATGAGAAGA
AGCAGCTGAGCCTGATACGGGTGGAGCTGCTGACCTTCCAGGAGCGATACTACAAGATGAAGGAGGAGCG
GGACAGCTACAATGACGAGCTCGTCAAGGTCAAGGACGACAACTACAACTTAGCCATGCGCTACGCCCAG
CTCAGTGAGGAGAAAAACATGGCGGTGATGAGGAGCCGCGACCTCCAACTCGAGATCGACCAGCTCAAAC
ACCGACTGAACAAGATGGAGGAGGAATGCAAGCTGGAGAGAAATCAGTCCCTCAAGCTCAAGAATGACAT
CGAGAACCGGCCCAGGAAGGAGCAGGTCCTGGAGCTGGAGCGGGAGAATGAGATGCTGAAGACGAAAATT
CAGGAGCTGCAGTCCATCATCCAGGCTGGCAAGCGCAGCCTCCCTGACTCAGACAAGGCCATCTTGGACA
TCCTGGAACATGACCGGAAGGAGGCGCTAGAGGACCGGCAGGAACTGGTCAACAAAATTTACAACCTACA
AGAGGAAGTCCGCCAGGCGGAGGAGCTGCGGGATAAGTACCTGGAGGAGAAGGAAGACCTGGAACTCAAG
TGTTCAACCCTGGGGAAGGACTGTGAAATGTACAAGCACCGCATGAACACAGTTATGCTGCAGCTGGAGG
AGGTGGAGCGGGAGCGGGACCAGGCCTTCCACTCCCGAGATGAGGCACAGACACAGTACTCACAGTGCTT
AATCGAGAAGGACAAGTACCGGAAGCAGATCCGGGAGCTGGAGGAGAAGAACGATGAGATGCGTATTGAG
ATGGTGAGGAGGGAGGCCTGTATTGTCAACCTGGAAAGCAAGCTCCGGCGCCTGTCCAAGGACAACGGCA
GCCTCGACCAGAGTCTGCCTAGACACCTTCCAGCCACCATCATCTCACAGAACCTTGGAGACACCAGCCC
CAGGACCAATGGCCAGGAAGCTGATGATTCTTCAACCTCAGAAGAGTCTCCCGAAGACAGCAAGTACTTT
CTGCCTTACCACCCACCCCGGCGCCGGATGAACCTAAAGGGCATCCAGCTGCAGAGAGCCAAATCCCCCA
TCAGCATGAAGCAAGCATCTGAGTTTCAAGTCAAGGGGCACGAAGAGGATTTCACAGACGGCAGCCCCAG
TTCCTCCCGCTCGCTGCCTGTCACCAGCTCTTTCTCCAAGATGCAACCCCATCGGAGCCGCAGCAGCATC
ATGTCAATCACGGCAGAGCCCCCGGGAAATGACTCCATAGTCAGACGCTGTAAGGAAGATGCGCCACACC
GGAGCACGGTGGAAGAAGACAACGATAGCTGTGGGTTTGATGCCTTAGACCTTGACGATGAAAATCACGA
ACGTTATTCCTTTGGACCTCCCTCCATCCACTCCTCCTCCTCTTCACACCAGTCAGAGGGACTGGATGCC
TACGACCTGGAGCAGGTCAACCTCATGTTACGAAAGTTCTCTTTGGAAAGGCCCTTCCGGCCATCGGTCA
CATCTGGGGGTCACGTGCGGGGCACCGGGCCCTTGGTCCAGCACACAACTCTGAATGGCGATGGGCTCAT
CACGCAGCTCACCCTTCTGGGCGGCAATGCACGCGGGAGCTTCATTCACTCTGTCAAGCCAGGCTCACTG
GCTGAGAGGGCCGGACTGCGTGAGGGCCACCAACTCCTGCTGCTGGAAGGTTGCATCCGAGGCGAAAGGC
AGAGCGTTCCACTGGATGCGTGCACAAAAGAAGAGGCCCGTTGGACCATCCAGAGGTGCAGTGGCCTCAT
CACTCTGCATTACAAGGTCAACCATGAAGGATACCGGAAGCTGCTGAAGGAGATGGAGGATGGTCTGATC
ACATCAGGGGACTCGTTCTATATCCGCCTGAACCTGAACATCTCCAGCCAGCTGGATGCCTGCTCCATGT
CCCTCAAGTGTGACGACGTGGTGCATGTCCTAGACACCATGTACCAGGACAGGCACGAGTGGCTGTGTGC
ACGAGTCGACCCCTTCACTGACCAAGACCTGGACACGGGCACCATCCCCAGCTACAGCCGGGCTCAACAG
CTTCTCCTGGTGAAGCTCCAGCGGTTGGTTCACAGAGGCAACCGGGAAGAGGCAGACAGCGCTCACCACA
CCCTGCGCAGCCTCCGGAACACCCTGCAGCCCGAAGAGATGCTTTCGACGAGCGACCCCCGAGTCAGCCC
CCGCCTCTCCAGAGCGAGTTTCTTCTTTGGCCAGCTCCTGCAGTTTGTCAGCCGGTCAGAAAACAAGTAC
AAAAGAATGAACAGCAATGAGCGCGTGAGAATCATCTCTGGGAGTCCCCTGGGGAGCCTCTCCCGGTCCT
CGCTGGATGCCACCAAACTCCTGACCGAGAAGCATGAAGAACTGGATCCTGAGAATGAGCTCAGCCGGAA
CCTCACCCTGATCCCTTACAGCCTGGTGCGCGCTTTCCACTGTGAGCGCCGCAGGCCTGTGCTCTTCACG
CCCACCATGCTGGCCAAGACATTGGTGCAGAAGCTGCTCAACTCAGGGGGTGCCATGGAGTTCACCATCT
GCAAGTCAGATATTGTCACAAGAGATGAGTTCCTCCGAAAGCAGAAGACAGAGACCATCATCTACTCCCG
GGAAAAGAACCCCAACACCTTTGAATGCATCGTCCCTGCCAACATTGAGGCTGTGGCAGCCAAGAACAAA
CACTGCCTGCTGGAGGCTGGGATCGGCTGTGTGCGCGACCTGATCAAGTGCAAGGTGTACCCCATAGTGC
TGCTCATCCGGGTGAGCGAGAAGAACATCAAACGGTTCAGGAAGCTGCTGCCGCGGCCAGAGACGGAAGA
GGAATTCCTGCGAGTGTGCAGGCTCAAAGAGAAGGAGCTGGAGGCGCTGCCCTGCCTCTACGCCACCGTG
GAAGCTGAGATGTGGAGCAGCGTGGAGGAGCTGCTGCGAGTCCTCAAAGACAAGATTGTAGAGGAGCAGC
GCAAGACCATCTGGGTGGACGAGGACCAGCTGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_175362
ORF Size 3465 bp
Insert Size 3465
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_175362.2, NP_780571
RefSeq Size 4112
RefSeq ORF 3465
Locus ID 108723
Cytogenetics 5|5 G2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.