Slc7a14 (NM_172861) Mouse Untagged Clone

CAT#: MC221533

Slc7a14 (untagged) - Mouse solute carrier family 7 (cationic amino acid transporter, y+ system), member 14 (Slc7a14), (10ug)

USD 989.00


Availability*
5 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Slc7a14 (NM_172861) Mouse Untagged Clone
Symbol Slc7a14
Synonyms A930013N06; BC061928
Vector pCMV6-Entry
Sequence Data
>MC221533 representing NM_172861
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAGTGGCTTTCTGGCCTCACTGGACCCGAGGCGGGTACAGTGGGGAGCCGCCTGGTATGCAATGCACT
CTCGGATCCTGCGCACCAAACCAGTGGAGTCCATGCTGGAGGGAACTGGGACCACCTCGGCGCATGGTAC
CAAGCTAGCCCAGGTTCTCACCACTGTAGACCTCATCTCTCTTGGAGTCGGCAGCTGTGTGGGCACTGGC
ATGTATGTGGTGTCTGGCCTGGTGGCCAAGGAGATGGCAGGGCCTGGGGTCATCGTGTCCTTCATCATTG
CTGCTGTTGCATCTATATTATCAGGTGTGTGCTATGCAGAGTTTGGAGTCCGAGTCCCCAAGACCACAGG
ATCTGCCTACACCTACAGCTATGTCACCGTTGGGGAGTTCGTGGCATTTTTCATCGGCTGGAACTTGATT
CTGGAGTACCTGATTGGCACGGCAGCTGGTGCCAGTGCTCTGAGCAGTATGTTTGACTCCCTGGCAAACC
ACAGCATCAGCCGCTGGATGGTGGACACCGTGGGAACCCTCAACGGCCTGGGGAAAGGGGAAGAGTCGTA
CCCAGACCTTCTGGCTCTGGTGATTGCCGTCATCGTGACCATCATTGTGGCTCTGGGAGTGAAAAACTCT
GTGGGCTTCAACAACGTCCTCAATGTGCTGAACCTGGCAGTGTGGGTGTTCATCATGATCGCAGGCCTCT
TCTTCATCAATGGCAAATACTGGGCTGAAGGCCAGTTCTTGCCCCACGGATGGTCAGGGGTGCTGCAAGG
AGCAGCCACGTGCTTCTATGCTTTCATTGGCTTTGACATCATTGCCACCACGGGTGAGGAAGCCAAGAAC
CCCAACACATCCATCCCTTACGCCATCACGGCATCCCTGGTCATCTGCCTGACAGCGTATGTGTCTGTGA
GCATGATCTTAACCCTGATGGTACCATATTACGCCATTGACACAGAGTCCCCGCTCATGGAGATGTTTGT
GGCCCATGGCTTCTATGCTGCGAAGTTTGTAGTGGCCATTGGCTCGGTGGCAGGACTGACCGTCAGCTTG
CTGGGCTCCCTGTTCCCCATGCCCAGGGTCATTTACGCCATGGCTGGCGATGGGCTGCTTTTCAGGTTCC
TGGCTCACGTGAGCTCCTACACAGAGACACCAGTGGTAGCTTGCATAGTGTCAGGCTTCCTGGCTGCTCT
CCTCTCTCTGCTGGTGAGCCTGAGGGACCTCATAGAGATGATGTCCATCGGCACGCTCCTCGCCTACACC
CTGGTCTCTGTCTGTGTCTTGCTTCTTCGGTATCAACCTGAGAGCGACATCGATGGTTTTGTCAAGTTCC
TGTCTGAGGAGCACACCAAGAAGAAGGAAGGCATCCTGGCTGACTGTGAGAAGGAAACTTGTTCTCCTGT
GAGTGAAGGGGAGGAATTTTCCAGCCCAGCCACCAACACCTGTGGGGCCAAAAACCTGCCGTCCTTGGGA
GACAATGAGATGCTCATAGGGAAATCAGATAAGTCCGCCTACAACGTCAACCACCCCAACTACGGCACTG
TGGATATGACCACGGGCATAGAAGCCGATGAATCAGAAAACATCTATCTCATCAAGTTGAAGAAGCTGAT
CGGACCCCGTTACTACACCATGAGAATCCGGCTGGGCCTTCCAGGCAAAATGGACCGGCCCACGGCGGCG
ACCGGGCACACGGTGACCATCTGCGTGCTCCTGCTGTTCATCCTCATGTTCATCTTCTGCTCCTTCATCA
TCTTTGGCTCTGAGTACATCTCAGGCCAGAGCTGGTGGGCCATCCTTCTGGTCGTTCTGATGATGCTGCT
GATCAGTGTGCTGGTGTTTGTAATCCTGCAGCAGCCAGAGAACCCCAAGAAGCTGCCGTACATGGCCCCC
TGCCTCCCCTTTGTACCTGCCTTTGCCATGTTGGTGAATATCTATCTCATGCTAAAGCTCTCCACCATCA
CATGGATCCGGTTTGCGGTCTGGTGCTTTGTGGGTATGCTCATTTATTTTGGGTATGGCATCTGGAACAG
CACCTTGGAAATCAGCGCCCGAGAGCAAGCCCTGCATCAGAGCACGTACCAGCGCTACGATGTGGATGAT
CCCTTTTCTGTGGAGGAGGGGTTCTCCTACGCCACCGAGGGCGAGAGCCAGGAGGACTGGGGTGGGCCCG
CCGAGGACAAAGGCTTCTATTACCAACAGATGTCAGATGCGAAGGCAAACAGCCGGACGAGTAGCAAAGC
GAAAAGCAAAAGCAAACACAAACAGAACTCGGAGGCCCTGATTGCAAATGACGAGTTAGATTGCTCTCCG
GAGTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_172861
ORF Size 2316 bp
Insert Size 2316
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_172861.3, NP_766449
RefSeq Size 8869
RefSeq ORF 2316
Locus ID 241919
Cytogenetics 3|3 A3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.