Pard3 (NM_001122850) Mouse Untagged Clone

CAT#: MC221245

Pard3 (untagged) - Mouse par-3 (partitioning defective 3) homolog (C. elegans) (Pard3), transcript variant 4, (10ug)

USD 948.00


Availability*
6 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Pard3 (NM_001122850) Mouse Untagged Clone
Symbol Pard3
Synonyms AA960621; AI256638; Asip; D8Ertd580e; Par-3; Par3; Pard-3; Pard3a; Phip
Vector pCMV6-Entry
Sequence Data
>MC221245 representing NM_001122850
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAAAGTGACCGTGTGCTTCGGGAGGACCCGGGTGGTCGTGCCGTGCGGAGATGGCCGCATGAAAGTTT
TCAGCCTCATCCAGCAGGCGGTGACCCGCTACCGGAAGGCCGTGGCCAAGGATCCAAACTACTGGATACA
GGTGCATCGCTTGGAGCATGGAGATGGAGGGATTCTAGACCTGGATGACATCCTCTGTGACGTTGCTGAT
GACAAAGACAGACTGGTAGCAGTATTTGATGAACAGGATCCCCACCATGGAGGAGATGGTACCAGCGCCA
GCTCCACGGGAACCCAGAGTCCAGAGATATTCGGCAGTGAGCTGGGCACCAACAATGTTTCTGCTTTTCA
GCCTTATCAAGCCACAAGTGAAATTGAGGTCACGCCTTCAGTTCTTCGGGCAAATATGCCTCTTCATGTC
CGCCGGAGCAGCGACCCAGCTTTAACTGGCCTTTCCACTTCTGTCAGTGATAACAACTTTTCCTCAGAGG
AGCCCTCCAGGAAAAACCCCACCCGCTGGTCCACGACAGCTGGCTTTCTCAAGCAGAACACCGCTGGAAG
TCCCAAAACCTGCGACAGGAAGAAAGATGAAAACTACAGAAGCCTTCCACGGGATCCCAGTAGCTGGTCC
AACCAGTTCCAGCGAGACAACGCCCGCTCCTCCCTGAGCGCCAGCCACCCAATGGTAGACCGGTGGCTGG
AGAAGCAAGAACAGGATGAGGAAGGCACAGAAGAAGACAGCAGCCGAGTGGAGCCGGTTGGACATGCTGA
TACCGGATTGGAGAACATGCCCAACTTTTCCCTCGATGATATGGTAAAGCTCGTACAAGTCCCCAACGAT
GGAGGGCCCCTGGGAATCCATGTAGTGCCTTTCAGTGCTCGAGGCGGCAGAACATTGGGGTTGTTAGTGA
AGCGGTTGGAGAAAGGCGGTAAGGCTGAGCAAGAAAACCTTTTCCATGAGAATGACTGCATTGTGAGGAT
TAACGATGGAGATCTTCGAAACAGAAGATTTGAGCAAGCACAACATATGTTCCGCCAAGCTATGCGTGCG
CGTGTCATTTGGTTCCATGTGGTCCCTGCAGCAAACAAGGAGCAATATGAACAACTGTCCCAACGCGAGA
AGAACAACTACTCCCCAGGCCGCTTCAGCCCTGACAGCCACTGTGTGGCCAACAGGAGTGTGGCCAACAA
TGCCCCTCAAGCATTGCCCAGAGCACCCAGACTGAGTCAGCCACCCGAGCAGCTGGATGCTCACCCCCGA
CTACCTCATAGTGCTCACGCCTCAACCAAACCACCCGCAGCCCCGGCCTTGGCTCCACCCAGTGTGCTTA
GTACCAACGTAGGCAGTGTGTACAACACGAAGAAAGTAGGCAAGAGGCTCAACATCCAGCTTAAGAAAGG
TACAGAAGGACTGGGATTCAGCATCACCTCCCGGGACGTCACCATAGGTGGCTCAGCTCCCATTTATGTC
AAGAATATCCTTCCTCGAGGGGCTGCCATTCAGGATGGCAGACTCAAGGCAGGAGACCGGCTAATAGAGG
TCAATGGAGTAGATTTAGCAGGCAAATCCCAGGAGGAAGTTGTTTCCCTGTTGAGAAGCACCAAGATGGA
GGGGACTGTGAGCCTTCTGGTCTTTCGTCAGGAAGAGGCTTTCCACCCAAGGGAAATGAATGCTGAACCA
AGCCAGATGCAGACTCCAAAAGAAACGAAAGCTGAAGATGAGGACGTTGTTCTCACACCCGATGGTACCA
GGGAGTTTCTGACTTTTGAAGTTCCACTGAATGACTCAGGATCTGCAGGGCTTGGTGTCAGTGTCAAGGG
GAACCGTTCCAAAGAGAACCACGCAGATTTGGGGATCTTCGTTAAATCCATTATCAATGGTGGAGCTGCA
TCTAAAGATGGAAGGCTGAGGGTAAATGACCAGCTGATAGCTGTGAATGGAGAATCTCTACTGGGCAAAG
CCAACCAGGAAGCCATGGAGACTCTACGGAGGTCCATGTCCACCGAGGGCAACAAGCGTGGCATGATCCA
GCTCATTGTGGCGAGGCGGATCAGCAGATGTAACGAGCTGCGGTCTCCTGGGAGCCCTGCTGCACCTGAG
CTGCCCATCGAGACAGAACTGGATGACCGAGAACGCAGGATCTCACACTCCCTCTACAGTGGGATCGAGG
GGCTGGATGAGTCGCCCACCAGGAACGCAGCACTGAGCAGGATAATGGGAACATAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001122850
ORF Size 2226 bp
Insert Size 2226
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001122850.1, NP_001116322
RefSeq Size 4178
RefSeq ORF 2226
Locus ID 93742
Cytogenetics 8 E2|8 74.66 cM
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.