Hic2 (NM_178922) Mouse Untagged Clone

CAT#: MC219689

Hic2 (untagged) - Mouse hypermethylated in cancer 2 (Hic2), (10ug)

USD 783.00


Availability*
4 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Hic2 (NM_178922) Mouse Untagged Clone
Symbol Hic2
Synonyms AA409108; HRG22; mKIAA1020
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>MC219689 representing NM_178922
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGTTTCTGGGCCCCTGGCACTCCGGTGGTGCCCGTGGGCAGGGCACAGGGACATGGGGCCAGACATGG
AGCTTCCCAGCCATTCAAAACAGCTCCTGCTACAGCTGAACCAGCAGAGGGCCAAGGGCTTCCTGTGTGA
CGTCATCATCATGGTGGAGAACTCTATCTTCCGGGCCCACAAGAATGTCCTGGCTGCTAGCAGCATCTAC
TTCAAGTCCCTGGTCCTGCATGATAACCTCATCAACTTAGACACAGACATGGTCAGCTCCACTGTGTTCC
AGCAGATCCTGGACTTCATCTACACAGGCAAGCTCCTGCCCAGTGACCAGCCATCTGAGCCAAACTTCAG
CACTCTACTCACTGCTGCCAGCTACCTCCAGCTGCCTGAGTTGGCAGCCCTCTGTCGCCGCAAACTGAAG
CGAGCTGGCAAGCCCTTTGGCCCTGGACGAGTGGGTACTGCTGGCATAGGGCGACCAACCCGCAGTCAGC
GGCTGTCCACAGCCTCTGTCATCCAGGCTCGATTTCCAGGGCTTGTAGATGTGCGTAAAGGACACCCTGC
TCCCCAGGAGCTCCCTCAGGCCAAAGGCTCAGATGATGAGCTTTTTCTGGGCACCTCCACTCAGGAGAGC
ACACACGGCCTGGGCTTGGGGGGTCCAGCTGGTGGGGAGATGGGCTTGGGGGGCTGCAGCACCAGCACCA
ATGGGAGTAGTGGGGGCTGTGAGCAGGAGCTGGGCTTGGACCTGTCCAAGAAGAGCCCACCCTTACCTCC
TACAACCCCTGGCCCCCACCTCACACCCGAGGACCCAGCCCAGCTGAGTGACAGCCAGCGAGAGTCACCC
GCACCCACATCGACCTCTGCCCTGCCTGTCGGCAATAGTGCCTCATTTGTTGAGCTGGGGGCCACTCCTG
AGGAGCCCATGGATGTGGAAGGGGCTGAGGAAAACCACCTGAGTCTGCTGGAAGGACAGGGTGGGCAGCC
TCGCAAGAGCCTCCGGCATTCAGCCCGCAAAAAAGATTGGAACAAAAAGGAACCTGTGGCTGGGTCCCCC
TTTGATAGGAGAGAAACAGGATCTAAGGGTTCCTGCCCAGGGGAAGAAGGTGAAGGGACTGGGGACAGGG
TTCCCAATGGCGTTCTGGCTAGCAGTGCTGGTGGAGGTGGCCCCAGTGCATCGTATGGGGAGCAGTCATT
CCCCTGCAAGGAGGAGGAGGAGAATGGCAAAGATGGGAGTGAGGACAGTGGGCAGAGTGGGAGTGAGGGG
GGCAGCGGCCATACTGGCGCCCACTATGTATACCGGCAGGAAGGCTATGAGACAGTGTCATATGGGGACA
ATGTTTATGTGTGCATCCCCTGTGCCAAGGGCTTCCCCAGCTCTGAGCAGCTCAATGCTCACGTGGAGAC
ACACACGGAGGAGGAGTTATTCATCAAGGAAGAAGGGGCTTATGAGACCGGCAGTGGGGGTGCCGAGGAG
GAGGCTGAGGACCTGTCAACACCTAGTGCAGCCTACACAGCTGACTCTCGTCCTTTCAAGTGCTCAGTTT
GTGAGAAGACCTACAAGGACCCAGCCACACTGCGGCAACACGAGAAGACACACTGGTTGACCCGTCCGTT
CCCCTGCAACATTTGTGGAAAGATGTTCACACAGCGAGGCACTATGACACGCCACATGCGGAGCCACCTG
GGCCTGAAGCCCTTTGCCTGTGATGAGTGTGGTATGCGTTTCACTCGCCAGTACCGCCTCACAGAGCACA
TGCGTGTGCACTCAGGTGAGAAGCCCTATGAGTGCCAGCTCTGTGGAGGCAAGTTCACCCAACAGCGCAA
CCTCATCAGCCACCTGCGCATGCACACTTCCCCTTCCTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_178922
ORF Size 1860 bp
Insert Size 1860
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_178922.3, NP_849253
RefSeq Size 6360
RefSeq ORF 1860
Locus ID 58180
Cytogenetics 16|16 A3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.