Optn (NM_181848) Mouse Untagged Clone

CAT#: MC219312

Optn (untagged) - Mouse optineurin (Optn), (10ug)


  "NM_181848" in other vectors (4)

Reconstitution Protocol

USD 817.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (2)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Optn"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Optn
Synonyms 4930441O07Rik; FIP2; HYPL; NRP
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC219312 representing NM_181848
Red=Cloning site Blue=ORF

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCCCATCAACCTCTGAGCTGCCTGACTGAGAAGGGGGACAGCCCTTGTGAGACCCCAGGAAATGGAC
CCTCCAATATGGTTCACCCCAGCCTGGACACATTCACCCCTGAGGAGCTGCTGCAGCAAATGAAGGAACT
CCTGGTTGAGAACCACCAGCTGAAAGAAGCCATGAAGCTAAATAATCAAGCTATGAAAGGGCGATTTGAG
GAGCTGTCCGCCTGGACAGAGAAGCAGAAGGAAGAGCGCCTGTTGTTTGAGATGCAAAGCAAAGAGGTTA
AGGAGCGCCTTAAGGCCCTGACTCATGAAAATGAGAGGCTGAAGGAAGAGCTTGGAAAATTCAAAGAGAA
ATCAGAAAAGCCATTGGAAGACCTCACAGGTGGCTACAGGTATCCCAGAGCCTTGGAGGAGGAAGTGGAG
AAGCTGAAGACCCAGGTGGAGCAGGAAGTGGAGCATCTGAAGATCCAGGTGATGCGCCTTCGGGCTGAAA
AGGCAGACCTGCTGGGCATCGTCTCAGAACTGCAGCTCAAACTCAACTCCGGCGGCTCCTCGGAAGACTC
CTTCGTTGAGATCAGGATGACCGAAGGAGAGACTGAAGGGGCAATGAAGGAGATGAAGAACTGCCCTACA
CCCACAAGAACAGACCCCATCAGCTTGAGCAACTGTACAGAGGATGCCAGGAGTTGTGCGGAGTTTGAAG
AACTGACTGTGAGCCAGCTTCTGCTTTGCCTAAGGGAAGGAAACCAAAAGGTGGAGAGACTTGAAGTCGC
CCTCAGAGAAGCCAAAGAAAGAATTTCAGATTTTGAAAAGAAAGCAAATGGCCATTCTTCTACTGAGAAG
CAGACAGCGAGGAGAGCAGACAGAGAGAAGGAGGACAAAGGCCAAGAGAGTGTTGGAAGCGAAGTGGAAA
CACTGAGCATTCAAGTGACCTCTCTGTTTAAGGAGCTTCAAGAGGCACACACAAAACTCAGTGAGGCTGA
GCTGATGAAGAAGAGACTTCAAGAAAAGTGTCAGGCTCTGGAGAGGAAGAACTCTGCAACACCATCAGAG
CTGAATGAAAAGCAAGAGCTCGTTTACAGTAACAAGAAGTTAGAGCTGCAGGTGGAGAGCATGCGCTCCG
AAATCAAGATGGAGCAGGCCAAGACAGAGGAGGAGAAGTCCAGGTTAGCCACTCTGCAGGCAACTCACAA
CAAGCTCCTTCAAGAACATAATAAGGCACTGAAAACAATTGAAGAACTAACCAAGCAACAGGCAGAAAAG
GTGGACAAGATGTTGCTGCAGGAGCTCAGCGAGAAGCTGGAGCTGGCAGAGCAGGCTCTGGCATCCAAAC
AGCTCCAGATGGATGAGATGAAGCAGACGCTCGCTAAGCAGGAGGAAGACCTGGAGACCATGGCCGTCCT
CAGGGCTCAGATGGAGGTGTACTGCTCAGATTTTCACGCTGAGAGAGCAGCAAGAGAGAAGATTCATGAA
GAAAAGGAGCAGCTGGCCTTGCAGCTCGCGATTTTGCTGAAAGAGAACAATGACATTGAAGAGGGAGGCA
GTAGACAGTCCCTGATGGAAATGCAGTGCCGACACGGGGCAAGAACCAGTGACTCTGACCAGCAGACTTA
CCTGTTTCAAAGAGGAGCCGAGGACAGGAGCTGGCAGCACGGGCAGCAGCCTCGCAGTATTCCGATTCAC
TCCTGCCCCAAGTGCGGAGAGGTCCTGCCGGACATCGACACGCTTCAGATCCATGTGATGGACTGCATCA
TTTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_181848
Insert Size 1755 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC061185, AAH61185
RefSeq Size 2443 bp
RefSeq ORF 1755 bp
Locus ID 71648
UniProt ID Q8K3K8
Cytogenetics 2 3.15 cM
Gene Summary Plays an important role in the maintenance of the Golgi complex, in membrane trafficking, in exocytosis, through its interaction with myosin VI and Rab8. Links myosin VI to the Golgi complex and plays an important role in Golgi ribbon formation. Plays a role in the activation of innate immune response during viral infection. Mechanistically, recruits TBK1 at the Golgi apparatus, promoting its trans-phosphorylation after RLR or TLR3 stimulation. In turn, activated TBK1 phosphorylates its downstream partner IRF3 to produce IFN-beta. Plays a neuroprotective role in the eye and optic nerve. May act by regulating membrane trafficking and cellular morphogenesis via a complex that contains Rab8 and hungtingtin (HD). Mediates the interaction of Rab8 with the probable GTPase-activating protein TBC1D17 during Rab8-mediated endocytic trafficking, such as of transferrin receptor (TFRC/TfR); regulates Rab8 recruitnment to tubules emanating from the endocytic recycling compartment. Autophagy receptor that interacts directly with both the cargo to become degraded and an autophagy modifier of the MAP1 LC3 family; targets ubiquitin-coated bacteria (xenophagy), such as cytoplasmic Salmonella enterica, and appears to function in the same pathway as SQSTM1 and CALCOCO2/NDP52. May constitute a cellular target for adenovirus E3 14.7, an inhibitor of TNF-alpha functions, thereby affecting cell death.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) differs in the 3' UTR compared to variant 1. Variants 1 and 2 both encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.