Golm1 (NM_001035122) Mouse Untagged Clone

CAT#: MC218076

Golm1 (untagged) - Mouse golgi membrane protein 1 (Golm1), transcript variant 2, (10ug)

USD 691.00


Availability*
3 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Golm1 (NM_001035122) Mouse Untagged Clone
Symbol Golm1
Synonyms 2310001L02Rik; AW125446; D030064E01Rik; Golph2; GP73; PSEC0257
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>MC218076 representing NM_001035122
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGATGGGATTGGGGAATGGGCGTCGCAGCATGAAGTCTCCGCCCCTTATCCTGGCTGCCCTGGTGGCCT
GTGTTATTGTGCTAGGCTTCAACTACTGGATTGCTAGCTCGAGAAGCGTGGAACTCCAGACGCGCATTGT
AGAGCTGGAAGGCCGGGTCCGCAGGGCGGCTGCAGAGAGAGGTGCTGTAGAGCTCAAGAAGAATGAGTTC
CAGGGCGAGCTGCAGAAGCAGAGAGAGCAACTTGACAGGATCCAGTCTAGCCACAGCTTCCAGCTGGAGA
ATGTCAACAAGCTACACCAGGATGAGAAGGCGGTTTTAGTGAATAACATCACCACAGGCGAGAAGCTCAT
TCGAGACCTGCAAGACCAGTTGAAGGCACTGCAGAGGAGTTACAGCAGCCTGCAGCAGGATATCTTCCAA
TTCCAGAAGAACCAGACCAGCCTGGAGAAGAAGTTCTCCTATGACCTGAACCAGTGTATCAGCCAGATGA
CCGAGGTGAAGGAACAGTGTGACGAGCGGATAGAGGAGGTCATCAGAAAGCGAAACGAAGCACCGGGTTC
CAGAGACCTGGCTGAAACCAACAACCAACATCAGCAGGCCCTCAAGCCTCAGCCCAAGCTTCAGGAAGAA
GTCCCATCAGAGGAACAGATGCCACAAGAGAAAGGGGATGTGCCCAGAAACAAGTCCCAGATTCCAGCCC
CCAATTCAGAGAGCTTGGGTTTGAAGCCACAGGTGCAGAATGAGGAAACCAATGAGATTCAGGCTGTCGG
TGAGGAGCACCAACAGGCATCCATCCAAGGGCAGGCGGTGGCGGATGGCACTCGGGTAGGAGCTGAGAAA
CTCGATCAGCACACACAGCTACCAGCTGGCCTGTTGGCCAGGCCTGAGGAGGACTCTCAGTACCCTGAGC
GGGAGCAGCTTGTCATCCGGGATAGGCAGGAGCAGCAGCGTGCATCAGAGGAAGGGGGAGGCCAGAAGAA
CCCAGGAGATGAATACGACATGGATGAAAACGAAGCAGAATCTGAGAGGGAGAAGCAGGCAGCCCTTGCA
GGGAATGACAGAAATATAAATGTTCTTAATGCTGACGCTCAGAAGAGAGGCATAATAAATGTGCCCGTCG
GGAGTGAAAGGCAGAGCCACATTCTAAATCAAGTAGGCATTCATATTCCTCAACAAGCCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001035122
ORF Size 1182 bp
Insert Size 1182
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001035122.2, NP_001030294
RefSeq Size 3557
Locus ID 105348
Cytogenetics 13|13 B2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.