Golm1 (NM_001035122) Mouse Untagged Clone

CAT#: MC205722

Golm1 (untagged) - Mouse golgi membrane protein 1 (Golm1), transcript variant 2, (10ug)

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Golm1 (NM_001035122) Mouse Untagged Clone
Symbol Golm1
Synonyms 2310001L02Rik; AW125446; D030064E01Rik; Golph2; GP73; PSEC0257
Vector pCMV6-Kan/Neo
Sequence Data
Fully Sequenced ORF
>BC011152
GCGCCTCGCTGCCCCGCAGGTTCTCGGCCCTGGTTCTAAGATGATGGGATTGGGGAATGGGCGTCGCAGC ATGAAGTCTCCGCCCCTTATCCTGGCTGCCCTGGTGGCCTGTGTTATTGTGCTAGGCTTCAACTACTGGA TTGCTAGCTCGAGAAGCGTGGAACTCCAGACGCGCATTGTAGAGCTGGAAGGCCGGGTCCGCAGGGCGGC TGCAGAGAGAGGTGCTGTAGAGCTCAAGAAGAATGAGTTCCAGGGCGAGCTGCAGAAGCAGAGAGAGCAA CTTGACAGGATCCAGTCTAGCCACAGCTTCCAGCTGGAGAATGTCAACAAGCTACACCAGGATGAGAAGG CGGTTTTAGTGAATAACATCACCACAGGCGAGAAGCTCATTCGAGACCTGCAAGACCAGTTGAAGGCACT GCAGAGGAGTTACAGCAGCCTGCAGCAGGATATCTTCCAATTCCAGAAGAACCAGACCAGCCTGGAGAAG AAGTTCTCCTATGACCTGAACCAGTGTATCAGCCAGATGACCGAGGTGAAGGAACAGTGTGACGAGCGGA TAGAGGAGGTCATCAGAAAGCGAAACGAAGCACCGGGTTCCAGAGACCTGGCTGAAACCAACAACCAACA TCAGCAGGCCCTCAAGCCTCAGCCCAAGCTTCAGGAAGAAGTCCCATCAGAGGAACAGATGCCACAAGAG AAAGGGGATGTGCCCAGAAACAAGTCCCAGATTCCAGCCCCCAATTCAGAGAGCTTGGGTTTGAAGCCAC AGGTGCAGAATGAGGAAACCAATGAGATTCAGGCTGTCGGTGAGGAGCACCAACAGGCATCCATCCAAGG GCAGGCGGTGGCGGATGGCACTCGGGTAGGAGCTGAGAAACTCGATCAGCACACACAGCTACCAGCTGGC CTGTTGGCCAGGCCTGAGGAGGACTCTCAGTACCCTGAGCGGGAGCAGCTTGTCATCCGGGATAGGCAGG AGCAGCAGCGTGCTGCAGAGGAAGGGGGAGGCCAGAAGAACCCAGGAGATGAATACGACATGGATGAAAA CGAAGCAGAATCTGAGAGGGAGAAGCAGGCAGCCCTTGCAGGGAATGACAGAAATATAAATGTTCTTAAT GCTGACGCTCAGAAGAGAGGCATAATAAATGTGCCCGTCGGGAGTGAAAGGCAGAGCCACATTCTAAATC AAGTAGGCATTCATATTCCTCAACAAGCCTGAAGAGATCCTACGGGGGTTCACTGTGACTCAACTGTGAA ATGGACAGCGAAATGAACGTCGGCCCATTATTGTGGGGTTTAATCAGTACATTTTGCAAAGAAAAAAAAA TGGGACCATCTCAGACAGTTTGGGGGTACTTTTAAAGTGTCTACAAGAGATGTCAAAATTGATCAAGCTT TGATTAACAGGTATTTCTTAAGCAGGTCAACACCAAAAAGAGAAATGAGGCTGTCCTGTCTAGGCAGCAG CACCTCCTCACCCTGCAGTGTAAGACAGAGTAGACTGAGGGCAGCTGCTGGCCACAGCGGCTCCCTCCTT GTGCTGCCGCTTGCCAGTTTCTGTCCACAGATATTAAGTAGCTCATCACTCCTGCACACACTTGATTTCC ACCATCAATGGCCTAGAGCTCTTACCGTCAGCATAAACACCACTAGTCAGTTCTATACAAAAGCTGTTCT GTGCAAAAACTGCATTAATTAAAAGACAGCCACCATATCTGGCTTACTTCAGGATTCGGAAGGCTGAGGC AGGAGATTGCTGCAAGTTCTGAGCCAGCCTAAAGCAACATAGTGAGTGCCAAGCTAAGATGAGCAAGAAT GAAAGCCCCTGTCTCAAATATCAGTGAGAGTTGTTACTTTAAAAAAGACTGGTTTAAATAACCTTCATTA TTCTTTTGATGTACAGAACACTATGAAGTTACTGACAATGCGAGCACCTATGGTCTGTGTTTGTTTGATT GGGCAGAGTTTCTAGTAAGTCACTCATCTCACTAAGAAAGGCAGTGCCTGCACTGCGCTCTGGACAAAGG CTGCATGGGCAGAGGTGTCCAAGAGGAAGGGTTGGCTGCTGGAGGATACTCAGGTTTCAAGCTGGATTCC TACGAAGGCAAGAGCAACACGAGCTGTTTTTCCCAAGTTTATATACTGTTTGAAAAAAACACAAGGTGAA TGTTAGTTTTGAAAGATTTGTAGTTCATTGATGGTAATGCATCGTAAGTCTTGATTCCGATCAGCAGCTT CTGATTGCAGACTGACTGCAGTCACACTGACGACTCGTTCCAGAAACGATCTCTCTGAAGAGTGGCTGAT CTGACTCTGAAGTGCTGGCTAAATAGGAAGCAGCAGCACTAGAGGCACAGGGGCTGAAGATCCCTGCAGT GAAGTGGATGCCGGGTGGTCCAGCTGTCTGTGCCTCTTTAAAGCACACATTTAAACCCCTATGGCAGACG TGGGTTGTTTCTCACTGCAGAACTACCCAGTTCTACCCCATGTTTAGATGAGTACTGTTTAATGTCACAA GCCATTTTCCTTTACACTTTAACTTGCCAGAGCCTCAGATGGACTGTTCTTACACCTTTTCTGCTCCTAG GTCCCAAACTCAAGGGGACTTTGTATTTCTAGTGCTTGTTTTCTACCTTAATCTGGTTTGGGTTTAAAGT GTAGATATTGCTGACAGGCTGTGCTGATTTCCTTTTTAACAAGTACAATAGGTAAGGGCCACATTCTACC CTTTGGGTTCTAAGATTCCAGAGTACCAATAGCCATGCATGACAGCTGAGCCATACCACCTCCGTACTGA CCAGGAAGTAACCAACATCCTGTCTTCGCTAGCATCTTGATCAAGTCCAGTCAGGCATGCTTCAGTGTTT CTAGGAAATGGAAGGTGCCACAGGGTTGGGCTGGCATAGCTCCGTGAGAACTTCTACCTAGCCAGTATGT GTGAGTCCCTGGGTCGCATCCTCAGCACCAACGAACACTGTCACATTAGAGTTAGGCCACTGAAATCTTA GAGTCATTTTTGCTGTAAGCCAAATGAACTAGCAATAGTCAGGCCAAACCACAAAGCCAGATTGAATTTC AGGGTGGCTCACTCTGCTAAAAGCACTGCCCCTTCAGAGTACAAATGGGAAACCCCACGGGCTTAGACAG TTGTCACAGCACACCAGTGACAAGACCAGCAGAGGAATGAGCAGCAAATCAAGGATGGGGTCTCTTGCTG GTGGCCAAGAACAAAACCTACACCTCAGGGCACTTGGGACTTCAGCTGGAACAAAGGGATGCACCACTTT CCAACAAGACCTGAAACTCAGCGGCCTACAAACTCCTACCTGATACCAGCAGCAGACACTGCAGTGTGAT GTGGTTTTCCTTCAACTGCATGACTAAAGACCCTTAGAAATCTGTGTCACAACACAGTCACAATCCTCAT GTACTTTAGCGATCCTCTTACCTCAAAATCAATTTGTAATTTGACCAGAATCTTAAATCCTTAATAAATC TTGTGTTTTGAAACTTCAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
Tag Tag Free
ACCN NM_001035122
ORF Size 1182 bp
Insert Size 1182
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC011152, NP_001030294
RefSeq Size 3534
Locus ID 105348
Cytogenetics 13|13 B2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.