Asrgl1 (BC016106) Mouse Untagged Clone

CAT#: MC217824

Asrgl1 (untagged) - Mouse asparaginase like 1 (cDNA clone MGC:27691 IMAGE:4921265), (10ug)


  "BC016106" in other vectors (4)

Reconstitution Protocol

USD 330.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Rabbit Polyclonal Anti-Asrgl1 Antibody
    • 100 ul

USD 539.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Asrgl1"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Asrgl1
Synonyms ALP, ALP1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC016106
Red=Cloning site Blue=ORF Green=Tags(s)

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGATGCTAGTATCATGGATGGGAAGGACCTGTCTGCAGGTGCAGTGTCTGCCGTGCGCTGTATCGCAA
ATCCCGTTAAACTTGCACGGCTTGTTATGGAAAAGACACCTCATTGCTTTCTGACTGGCCATGGTGCAGA
GAAATTTGCAGAAGACATGGGGATTCCACAGGTCCCTGTAGAAAAACTGATAACTGAGAGAACCAAGAAG
CACCTGGAGAAAGAGAAGCTTGAGAAGGGAGCACAGAATGCTGACTGCCCTAAAAACTCAGGAACTGTGG
GTGCTGTTGCCTTGGACTGCAGAGGAAACTTGGCTTACGCAACCTCTACTGGGGGGATTGTCAATAAAAT
GGTTGGCCGAGTTGGAGACTCGCCTTGCATAGGAGCTGGAGGTTACGCAGATAATAACCTTGGAGCCGTT
TCAACCACAGGACATGGGGAAAGTATCCTGAAGGTGAATCTGGCCAGACTTGCCCTCTTCCATGTAGAGC
AAGGAAAGACCGTAGAGGAGGCTGCTCAGTTGGCATTGGATTACATGAAGTCAAAACTCAAAGGTCTAGG
TGGCCTCATCTTGGTCAACAAAACAGGAGACTGGGTGGCAAAGTGGACCTCTGCCTCCATGCCCTGGGCA
GCGGTGAAGAATGGCAAGCTGCAGGCCGGCATTGACCTCTGTGAGACCAGGACAAGGGACCTACCTTGCT
AG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAG
GTTTAA
Restriction Sites SgfI-MluI     
ACCN BC016106
Insert Size 702 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC016106, AAH16106
RefSeq Size 1723 bp
RefSeq ORF 701 bp
Locus ID 66514
Cytogenetics 19 A
Gene Summary Has both L-asparaginase and beta-aspartyl peptidase activity. May be involved in the production of L-aspartate, which can act as an excitatory neurotransmitter in some brain regions. Is highly active with L-Asp beta-methyl ester. Besides, has catalytic activity toward beta-aspartyl dipeptides and their methyl esters, including beta-L-Asp-L-Phe, beta-L-Asp-L-Phe methyl ester (aspartame), beta-L-Asp-L-Ala, beta-L-Asp-L-Leu and beta-L-Asp-L-Lys. Does not have aspartylglucosaminidase activity and is inactive toward GlcNAc-L-Asn. Likewise, has no activity toward glutamine.[UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.