Pftk1 (BC068134) Mouse Untagged Clone

CAT#: MC217730

Pftk1 (untagged) - Mouse PFTAIRE protein kinase 1 (cDNA clone MGC:95907 IMAGE:6834018), (10ug)

USD 691.00


Availability*
2 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Pftk1 (BC068134) Mouse Untagged Clone
Symbol Pftk1
Synonyms mKIAA0834
Vector pCMV6-Entry
Sequence Data
>BC068134
Red=Cloning site Blue=ORF Green=Tags(s)

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCTACCCGGAACTGCCAGGGGACAGATTCAGTGATCAAGCACCTGGACACAATTCCTGAAGACAAGA
AAGTCAGGGTTCAGAGGACGCAGAGCACTTTTGACCCATTTGAGAAACCAGCCAACCAAGTCAAAAGGGT
CCATTCTGAGAACAATGCATGCATTAACTTTAAATCCTCCTCTGCTGGCAAAGAGTCACCTAAAGTTCGG
CGGCACTCCAGCCCCAGCTCGCCAACGAGTCCCAAATTTGGAAAAGCTGACTCATACGAAAAACTGGAAA
AACTGGGGGAAGGATCTTATGCAACAGTGTACAAAGGGAAAAGCAAAGTGAATGGGAAGCTGGTGGCTCT
AAAGGTGATCCGGCTGCAGGAAGAAGAGGGCACACCTTTCACAGCCATCAGGGAAGCTTCCCTGTTGAAA
GGACTAAAGCACGCCAACATCGTGTTGCTTCACGACATCATCCACACTAAGGAAACCCTGACCCTTGTCT
TTGAATACGTGCACACTGATTTATGTCAGTACATGGACAAGCACCCTGGAGGACTCCATCCAGATAATGT
GAAGTTGTTTTTATTTCAGCTGCTGCGAGGACTGTCTTACATCCACCAGCGTTATATTTTGCACAGAGAC
CTGAAACCGCAGAACCTTCTCATCAGCGATACGGGGGAGTTGAAGCTGGCAGATTTCGGTCTGGCAAGAG
CAAAATCCGTCCCTAGCCACACATACTCCAATGAAGTGGTTACCTTGTGGTACAGACCTCCAGATGTTCT
TCTGGGCTCTACAGAATATTCCACCTGCCTTGACATGTGGGGAGTTGGCTGTATCTTCGTTGAGATGATC
CAAGGAGTTGCTGCGTTTCCAGGAATGAAAGACATTCAGGATCAACTTGAACGGATATTTCTGGTTCTTG
GAACACCGAATGAGGACACGTGGCCTGGAGTTCATTCTTTACCACATTTTAAGCCAGAACGCTTTACCGT
GTACAGCTCTAAAAGCCTTAGACAAGCATGGAATAAGCTCAGCTATGTAAATCATGCTGAAGACTTGGCC
TCCAAGCTTCTCCAGTGTTCCCCAAAGAACAGGCTATCAGCACAGGCCGCCTTGAGCCATGAGTATTTCA
GCGATCTGCCTCCACGGCTATGGGAGCTGACTGATATGTCTTCTATTTTTACCGTCCCAAATGTGAGATT
GCAACCAGAAGCTGGAGAGAGCATGAGGGCCTTTGGAAAAAACAATAGTTATGGGAAAAGCCTATCGAAC
AGCAAACACTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAG
GTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN BC068134
ORF Size 1272 bp
Insert Size 1272
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC068134,
RefSeq Size 5127
RefSeq ORF 1272
Locus ID 18647
Cytogenetics 5 A1|5 2.61 cM
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.